T-DNA Browser >> T-DNA List >> T-DNA Detail Information
 
T-DNA Name  B08-B41
Reference (Species)  Magnaporthe oryzae 5 CONTIG
Border (Vector / Readthrough)  RB (Plus) (Y)
Copy Number  1
Origin Info (ATMT)  B08-B4 ATMT0417B2
BLAST Search Result (2)  (Magnaporthe grisea 4 CONTIG) [2005-01-26 16:15:12]
 (Not defined) [2006-09-09 17:21:34]
There are 3 detail information.
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.200 : 1068501 ~ 1068501
Chromosome  2
TTL Info  
Locus Info  None (ORF DIS : 0 bp) (ORF Length : bp)
Near Locus Info  Near : 3' : MGG_05616.5 (715 bp) (Minus)
 Far   : 3' : MGG_05615.5 (741 bp) (Plus)
Range of Components
No Type Range Target
1 Border 11 ~ 79 (Plus)   2421 ~ 2489 (Plus)
2 Contig (200) 100 ~ 296 (Plus)   1068521 ~ 1068717 (Plus)
Sequences [A]
CNTGTNGNNNATGCTAGAGCANCTTGAGCTTGGATCAGATTGTCGTTTCCCGCCTTCAGTTTAAACTATCAGTGTTTGAA
GGGGTGGANNTNCTNNGGNTGAGCNTGANAAACAANGTTCCAGCCATGGAAACCTTCATCAAGTACAAGAGCGGCTACGT
GGTATAACGGTCATTATTGCTGCCTTCCAAATCGTGCAACTGCACAATGCCGTTAGCAGCAGACGCGGGTTCGACTCCCG
CCGTAGTNAACTACGGTACCACAAATCTGGGAATTTCTTTTTTGCCTTTTCTCCTC
CCACATGGGCNGCTCCGNNNGGGG
CAGGAAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNNNNNNNNNNNN
NNNNNGGNNNNNNNNGNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.189 : 957774 ~ 957774
Chromosome  5
TTL Info  
Locus Info  None (ORF DIS : 0 bp) (ORF Length : bp)
Near Locus Info  Near : 5' : MGG_13654.5 (693 bp) (Plus)
 Far   : 3' : MGG_09708.5 (768 bp) (Plus)
Range of Components
No Type Range Target
1 Border 11 ~ 79 (Plus)   2421 ~ 2489 (Plus)
2 Contig (189) 145 ~ 270 (Plus)   957585 ~ 957709 (Minus)
Sequences [B]
CNTGTNGNNNATGCTAGAGCANCTTGAGCTTGGATCAGATTGTCGTTTCCCGCCTTCAGTTTAAACTATCAGTGTTTGAA
GGGGTGGANNTNCTNNGGNTGAGCNTGANAAACAANGTTCCAGCCATGGAAACCTTCATCAAGTACAAGAGCGGCTACGT
GGTATAACGGTCATTATTGCTGCCTTCCAAATCGTGCAACTGCACAATGCCGTTAGCAGCAGACGCGGGTTCGACTCCCG
CCGTAGTNAACTACGGTACCACAAATCTGG
GAATTTCTTTTTTGCCTTTTCTCCTCCCACATGGGCNGCTCCGNNNGGGG
CAGGAAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNNNNNNNNNNNN
NNNNNGGNNNNNNNNGNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.195 : 2433031 ~ 2433031
Chromosome  1
TTL Info  
Locus Info  None (ORF DIS : 0 bp) (ORF Length : bp)
Near Locus Info  Near : 5' : MGG_08366.5 (978 bp) (Plus)
 Far   : 3' : MGG_08367.5 (1912 bp) (Plus)
Range of Components
No Type Range Target
1 Border 11 ~ 79 (Plus)   2421 ~ 2489 (Plus)
2 Contig (195) 150 ~ 263 (Plus)   2433101 ~ 2433210 (Plus)
Sequences [C]
CNTGTNGNNNATGCTAGAGCANCTTGAGCTTGGATCAGATTGTCGTTTCCCGCCTTCAGTTTAAACTATCAGTGTTTGAA
GGGGTGGANNTNCTNNGGNTGAGCNTGANAAACAANGTTCCAGCCATGGAAACCTTCATCAAGTACAAGAGCGGCTACGT
GGTATAACGGTCATTATTGCTGCCTTCCAAATCGTGCAACTGCACAATGCCGTTAGCAGCAGACGCGGGTTCGACTCCCG
CCGTAGTNAACTACGGTACCACA
AATCTGGGAATTTCTTTTTTGCCTTTTCTCCTCCCACATGGGCNGCTCCGNNNGGGG
CAGGAAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNNNNNNNNNNNN
NNNNNGGNNNNNNNNGNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
Comment  -
Create date / Update date  2005-01-20 16:47:00 /
 
Copyright 2007 Fungal Plant Pathology Lab. & FBL
E-mail : yonglee@snu.ac.kr
Magnaporthe oryzae TDNA Database