T-DNA Browser >> T-DNA List >> T-DNA Detail Information
 
T-DNA Name  0043A62
Reference (Species)  Magnaporthe oryzae 5 CONTIG
Border (Vector / Readthrough)  LB (Minus) (Y)
Copy Number  Not Exist!
Origin Info (ATMT)  ATMT0043A6
BLAST Search Result (2)  (Magnaporthe grisea 4 CONTIG) [2005-01-27 18:52:07]
 (Not defined) [2006-09-09 17:20:13]
There are 2 detail information.
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.187 : 15479 ~ 15479
Chromosome  4
TTL Info  
Locus Info  None (ORF DIS : 0 bp) (ORF Length : bp)
Near Locus Info  Near : 3' : MGG_11996.5 (1689 bp) (Minus)
 Far   : 5' : MGG_09337.5 (5683 bp) (Minus)
Range of Components
No Type Range Target
1 Border 3 ~ 64 (Plus)   8771 ~ 8832 (Minus)
2 Contig (186) (Dup) 68 ~ 67 (Plus)   1912606 ~ 1912651 (Plus)
3 ContigOverlap (Dup) 68 ~ 67 (Plus)  
4 ContigOverlap 68 ~ 69 (Plus)  
5 ContigOverlap 70 ~ 81 (Plus)  
6 Contig (52) (Dup) 70 ~ 81 (Plus)   3033 ~ 3078 (Minus)
7 ContigOverlap (Dup) 82 ~ 83 (Plus)  
8 Contig (200) 84 ~ 113 (Plus)   1032899 ~ 1032930 (Minus)
9 ContigOverlap (Dup) 84 ~ 83 (Plus)  
10 ContigOverlap 84 ~ 111 (Plus)  
11 Contig (125) 112 ~ 113 (Plus)   129030 ~ 129073 (Minus)
12 ContigOverlap (Dup) 112 ~ 113 (Plus)  
13 Contig (17) 114 ~ 113 (Plus)   363 ~ 394 (Plus)
14 Contig (178) 114 ~ 121 (Plus)   706732 ~ 706790 (Plus)
15 ContigOverlap 122 ~ 126 (Plus)  
16 Contig (187) 127 ~ 550 (Plus)   15536 ~ 15964 (Plus)
Sequences [A]
TTAAAACGTCCGCAATGTGTTATTAAGTTGTCTAAGCGTCAATTTGTTTACACCACAATATATCGNNCCTACGTTACTCT
N
GTAACAGCCATGGCGCTTAACCNCTGCGCCATCTCCCGCCCGACCTTTTATGCTACTTGNACCATCCAGNATAGCTCCA
GACAAACTAGATCAGAACCTCCTTGACATGTTCTTTTTGGTTAAATCGTGCAATTCTGTGTCAGCAAAAGGTAAAAATGC
AGATGTGNAAACCGAGAAATTTCTTGAACAAACCGNTTACAAATCTTTTGTTTTGTTGAAAAAGCCATTCTAGTAATCCG
CTATCTAGCAATCGTGCTATAAAGCCAAGTCACCATGGTCTGTTTCACCCCTGGAACTACGCCCAAAAAGCGTGTCCCAG
ACGACCAGGTTTCATCTCATATGTTGGTTCTCTCTTTGGATGCCCTCGGCATCGTAAGCTGACTCGACCTCAGGNTTGAC
ACCGCAATGGGCGAGCTCTTCGNCGTCTCGAGCCGNGACACCTGCTACCATTCATCCGGCTCACCTTCAT
AAGNCCCGCG
ACTAGAAAANGNNNNNNNNAANTCGGGGGNTGANTTTGAAAATGGNAACAATGGATGANCACCCTTNCCGTGNAAGCTCT
TTCCATGGNCCTGAANGNCNCCCNACAGGCCAGNANNGNGACNTTTGGNAATTGNAACCCTNATGGNCGAAAAGANCGCC
NTACCTTTTANNTAATGGANNGNTCCCGGGTTTTTCTATNCGGNNANTTCCAAAAANAATNCNTNCCCGNNTTTTTTGNC
CCAANANCNAANTANANNGGAGTGTCGNNNCNCNTTTNCGGGGGGCATNCCNATTNNNAAANGNCCNGNNNAATGTGGCN
GGCCCTTTTNNAGANCCGNATCCNTNGGGGGGGCNNANACCCAAAAAANAAAAATCCTTNNCNTGCNGGCCTTTTGNGNC
CANGNNNCCCNNNACCATNNTCCNGGC
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.187 : 2971736 ~ 2971736
Chromosome  4
TTL Info  
Locus Info  MGG_12237.5 (ORF DIS : 122 bp) (ORF Length : 159 bp)
Near Locus Info  Near : 3' : MGG_10368.5 (567 bp) (Minus)
 Far   : 3' : MGG_12236.5 (4162 bp) (Plus)
Range of Components
No Type Range Target
1 Border 3 ~ 64 (Plus)   8771 ~ 8832 (Minus)
2 Contig (195) (Dup) 68 ~ 67 (Plus)   2089426 ~ 2089471 (Minus)
3 ContigOverlap (Dup) 68 ~ 113 (Plus)  
4 Contig (195) 114 ~ 118 (Plus)   2232905 ~ 2232955 (Minus)
Sequences [B]
TTAAAACGTCCGCAATGTGTTATTAAGTTGTCTAAGCGTCAATTTGTTTACACCACAATATATCGNNCCTACGTTACTCT
NGTAACAGCCATGGCGCTTAACCNCTGCGCCAT
CTCCCGCCCGACCTTTTATGCTACTTGNACCATCCAGNATAGCTCCA
GACAAACTAGATCAGAACCTCCTTGACATGTTCTTTTTGGTTAAATCGTGCAATTCTGTGTCAGCAAAAGGTAAAAATGC
AGATGTGNAAACCGAGAAATTTCTTGAACAAACCGNTTACAAATCTTTTGTTTTGTTGAAAAAGCCATTCTAGTAATCCG
CTATCTAGCAATCGTGCTATAAAGCCAAGTCACCATGGTCTGTTTCACCCCTGGAACTACGCCCAAAAAGCGTGTCCCAG
ACGACCAGGTTTCATCTCATATGTTGGTTCTCTCTTTGGATGCCCTCGGCATCGTAAGCTGACTCGACCTCAGGNTTGAC
ACCGCAATGGGCGAGCTCTTCGNCGTCTCGAGCCGNGACACCTGCTACCATTCATCCGGCTCACCTTCATAAGNCCCGCG
ACTAGAAAANGNNNNNNNNAANTCGGGGGNTGANTTTGAAAATGGNAACAATGGATGANCACCCTTNCCGTGNAAGCTCT
TTCCATGGNCCTGAANGNCNCCCNACAGGCCAGNANNGNGACNTTTGGNAATTGNAACCCTNATGGNCGAAAAGANCGCC
NTACCTTTTANNTAATGGANNGNTCCCGGGTTTTTCTATNCGGNNANTTCCAAAAANAATNCNTNCCCGNNTTTTTTGNC
CCAANANCNAANTANANNGGAGTGTCGNNNCNCNTTTNCGGGGGGCATNCCNATTNNNAAANGNCCNGNNNAATGTGGCN
GGCCCTTTTNNAGANCCGNATCCNTNGGGGGGGCNNANACCCAAAAAANAAAAATCCTTNNCNTGCNGGCCTTTTGNGNC
CANGNNNCCCNNNACCATNNTCCNGGC
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
Comment  RAND
LB-ADM3
Create date / Update date  2005-01-27 18:52:04 /
 
Copyright 2007 Fungal Plant Pathology Lab. & FBL
E-mail : yonglee@snu.ac.kr
Magnaporthe oryzae TDNA Database