T-DNA Browser >> T-DNA List >> T-DNA Detail Information
 
T-DNA Name  0137B62
Reference (Species)  Magnaporthe oryzae 5 CONTIG
Border (Vector / Readthrough)  RB (Plus) (Y)
Copy Number  Not Exist!
Origin Info (ATMT)  ATMT0137B6
BLAST Search Result (2)  (Magnaporthe grisea 4 CONTIG) [2005-02-07 14:22:32]
 (Not defined) [2006-09-09 17:21:05]
There are 3 detail information.
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.183 : 387250 ~ 387250
Chromosome  3
TTL Info  
Locus Info  None (ORF DIS : 0 bp) (ORF Length : bp)
Near Locus Info  Near : 5' : MGG_13854.5 (256 bp) (Plus)
 Far   : 3' : MGG_07818.5 (2806 bp) (Plus)
Range of Components
No Type Range Target
1 Border 24 ~ 80 (Plus)   2434 ~ 2490 (Plus)
2 ContigBorder 81 ~ 81 (-)  
3 Contig (183) 82 ~ 592 (Plus)   386740 ~ 387251 (Minus)
Sequences [A]
CGGTNGGCGATGCTAGNANAGCTTTGAGCTTGGATCAGNATTGTCGTTTCCCGCCTTCAGTTTAAACTATCAGTGTTTGA
C
CAGTAACTTTGAGGAGAAACGAATCGCCGTACTGTTCTCATGGAGTATAGTTCACTTACCGCTGATCTTCCTTGTCGTG
CATCCCTTTCGCAAACTCCCGTTTAAGACTGTAGCGCAGCTCTGGCTCTCCATTCTTCCATGCGACTAACATCTCCGTAT
GCTGTTGGGCGCATAAATGTTAGCTTGCATTTGGAGCGGGTGGGCATGGCATTTACGCACCTTGTAAAGCAGCCCATTCC
CAGTGCCCGCTCGACTAGAGCTCTCACTTATCTCACCCACTCTAGCTGAGGTGAACACATGACATTTCAGTTTGGCACTA
ATCAAGACACGATATCCATCGTGAAGGTATTCATGCCCATCACTCTGCCAAAGCTGTCTTTCCATGTACATGAAATTTTC
GATTGTCATGTACGTTTTCGGTCTTTTAAGGTCTGACAACCCGATCTTCTTCTTTAGTGGCCCTTTAATATACTGTGTTT
AGTAAGTATAAGTGTTTTACCCAGTGACAAAA
GATTCGGAGACTTACATTGGNGATGGAATCCGTATGANCTCTCGTGAT
CAATGATTTAGGGTTGTNGNGATCCAGCCTGACACAAGCGACGNAAGTGATTGCGCACAGTCTGAACGGTAGCTTTGCNT
CCGGGTCAAGAATCCCCGAGTAAGCTGGCTAAAATTCGGCNANCTCTTCAAGTCCTNAATCGCTATGATNGCACCNGGCC
TTTTGTGGACCTCAGAANNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNT
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.187 : 2897331 ~ 2897331
Chromosome  4
TTL Info  
Locus Info  MGG_10390.5 (ORF DIS : 948 bp) (ORF Length : 759 bp)
Near Locus Info  Near : 5' : MGG_12233.5 (1426 bp) (Plus)
 Far   : 5' : MGG_12232.5 (2480 bp) (Minus)
Range of Components
No Type Range Target
1 Border 24 ~ 81 (Plus)   2434 ~ 2490 (Plus)
2 Contig (187) 135 ~ 560 (Plus)   2897384 ~ 2897809 (Plus)
3 Contig (187) 600 ~ 707 (Plus)   2897850 ~ 2897959 (Plus)
Sequences [B]
CGGTNGGCGATGCTAGNANAGCTTTGAGCTTGGATCAGNATTGTCGTTTCCCGCCTTCAGTTTAAACTATCAGTGTTTGA
C
CAGTAACTTTGAGGAGAAACGAATCGCCGTACTGTTCTCATGGAGTATAGTTCACTTACCGCTGATCTTCCTTGTCGTG
CATCCCTTTCGCAAACTCCCGTTTAAGACTGTAGCGCAGCTCTGGCTCTCCATTCTTCCATGCGACTAACATCTCCGTAT
GCTGTTGGGCGCATAAATGTTAGCTTGCATTTGGAGCGGGTGGGCATGGCATTTACGCACCTTGTAAAGCAGCCCATTCC
CAGTGCCCGCTCGACTAGAGCTCTCACTTATCTCACCCACTCTAGCTGAGGTGAACACATGACATTTCAGTTTGGCACTA
ATCAAGACACGATATCCATCGTGAAGGTATTCATGCCCATCACTCTGCCAAAGCTGTCTTTCCATGTACATGAAATTTTC
GATTGTCATGTACGTTTTCGGTCTTTTAAGGTCTGACAACCCGATCTTCTTCTTTAGTGGCCCTTTAATATACTGTGTTT

AGTAAGTATAAGTGTTTTACCCAGTGACAAAAGATTCGGAGACTTACATTGGNGATGGAATCCGTATGANCTCTCGTGAT
CAATGATTTAGGGTTGTNGNGATCCAGCCTGACACAAGCGACGNAAGTGATTGCGCACAGTCTGAAC
GGTAGCTTTGCNT
CCGGGTCAAGAATCCCCGAGTAAGCTGGCTAAAATTCGGCNANCTCTTCAAGTCCTNAATCGCTATGATNGCACCNGGCC
TTTTGTGGACCTCAGAANNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNT
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.200 : 232522 ~ 232522
Chromosome  2
TTL Info  
Locus Info  None (ORF DIS : 0 bp) (ORF Length : bp)
Near Locus Info  Near : 3' : MGG_05397.5 (505 bp) (Minus)
 Far   : 5' : MGG_05396.5 (1127 bp) (Minus)
Range of Components
No Type Range Target
1 Border 24 ~ 81 (Plus)   2434 ~ 2490 (Plus)
2 Contig (200) 399 ~ 465 (Plus)   232141 ~ 232205 (Minus)
Sequences [C]
CGGTNGGCGATGCTAGNANAGCTTTGAGCTTGGATCAGNATTGTCGTTTCCCGCCTTCAGTTTAAACTATCAGTGTTTGA
C
CAGTAACTTTGAGGAGAAACGAATCGCCGTACTGTTCTCATGGAGTATAGTTCACTTACCGCTGATCTTCCTTGTCGTG
CATCCCTTTCGCAAACTCCCGTTTAAGACTGTAGCGCAGCTCTGGCTCTCCATTCTTCCATGCGACTAACATCTCCGTAT
GCTGTTGGGCGCATAAATGTTAGCTTGCATTTGGAGCGGGTGGGCATGGCATTTACGCACCTTGTAAAGCAGCCCATTCC
CAGTGCCCGCTCGACTAGAGCTCTCACTTATCTCACCCACTCTAGCTGAGGTGAACACATGACATTTCAGTTTGGCACTA
ATCAAGACACGATATCCATCGTGAAGGTATTCATGCCCATCACTCTGCCAAAGCTGTCTTTCCAT
GTACATGAAATTTTC
GATTGTCATGTACGTTTTCGGTCTTTTAAGGTCTGACAACCCGATCTTCTTCTTTAGTGGCCCTTTAATATACTGTGTTT
AGTAAGTATAAGTGTTTTACCCAGTGACAAAAGATTCGGAGACTTACATTGGNGATGGAATCCGTATGANCTCTCGTGAT
CAATGATTTAGGGTTGTNGNGATCCAGCCTGACACAAGCGACGNAAGTGATTGCGCACAGTCTGAACGGTAGCTTTGCNT
CCGGGTCAAGAATCCCCGAGTAAGCTGGCTAAAATTCGGCNANCTCTTCAAGTCCTNAATCGCTATGATNGCACCNGGCC
TTTTGTGGACCTCAGAANNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNT
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
Comment  RB-ADM1
Create date / Update date  2005-02-07 14:22:27 / 2005-02-24 10:24:03
 
Copyright 2007 Fungal Plant Pathology Lab. & FBL
E-mail : yonglee@snu.ac.kr
Magnaporthe oryzae TDNA Database