T-DNA Browser >> T-DNA List >> T-DNA Detail Information
 
T-DNA Name  0141C42
Reference (Species)  Magnaporthe oryzae 5 CONTIG
Border (Vector / Readthrough)  RB (Plus) (Y)
Copy Number  Not Exist!
Origin Info (ATMT)  ATMT0141C4
BLAST Search Result (2)  (Magnaporthe grisea 4 CONTIG) [2005-02-07 14:22:33]
 (Not defined) [2006-09-09 17:22:08]
There are 1 detail information.
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.195 : 337892 ~ 337892
Chromosome  1
TTL Info  
Locus Info  None (ORF DIS : 0 bp) (ORF Length : bp)
Near Locus Info  Near : 3' : MGG_12269.5 (931 bp) (Plus)
 Far   : 3' : MGG_12270.5 (934 bp) (Minus)
Range of Components
No Type Range Target
1 Border 20 ~ 77 (Plus)   2432 ~ 2489 (Plus)
2 Contig (195) 340 ~ 788 (Plus)   338154 ~ 338602 (Plus)
Sequences [A]
CGGTGGGCGATGCTANAGNGCTTGAGCTTGGATCAGATTGTCGTTTCCCGCCTTCAGTTTAAACTATCAGTGTTTGANAN
AGGGGNAATNTGTTNNNNNNGTATNNANCNCATCNNNCTGTCTAGCCNCCGGGCGGATCNTGNCNAGNGNNCNNTTCNCN
NGTANCNNAGCCCCAGGNTTNCTAGAACGTGGATTCTTCTGGAGGGAATNGCCAGATTTACCTGCACCNGTCTCCTACAG
ACTNGCNTCNACCCCAGNGNACTCTTGGTATGNGGGTCTNGNNNNNAATNAGCTCATAGNTANACCGGTATCANCTGGAN
CGNGGCCNGNATAAAACAATTTATTGCTCGCTTGCCGTTGACATGCGACTTCGGACTCGATTCCTTCACACTGGGAGTTG
GACTGATCTGAAAGACATTTACACTGGAGAATAAAATTGGCAAGTAAACATAAGCACATACATGCATGTGATCCTGGTAT
ATAGTGTAGTGTTATATAAACATTCTGCGGCTTTTCATGGACGGTCCAGTTGGTCCATACAACCCGCGGGTCATCAAAGC
CGAATCGAGTGGCTTCATCAACCAAATGCCTAGCGGCGCTCACTAGATATTACAGCAACAAAAAGCCGGTTCAAAAAGCC
AAACCAGGAAAAACAGGGAANCCCTCGAAACGNTGAGCGAGGNAGTTAAAGATANCGGCGAGGCCCGCACACAATGCAGA
CGNCNCGACCGCNGAAGATGGGAAACCANCCGTNGGGNAGACNNAAAGNCCCANCCCCCAAANAGGGG
NNGNNAGNNGNN
GCNNGNCTTANAGACNCNGGAANGGNGGNNNCNGNTTTGGGCCNAANATGNCCNNAAAAAAGGNNNANGNNNTNNGGNNG
GGGAAGCCCCTGGCNGGTGGGNNGTNCCCCCNNGGGGGGGGNANCCCGGNCCCCCCCNNTTTTTCTT
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
Comment  RB-ADM1
Create date / Update date  2005-02-07 14:22:27 / 2005-02-24 10:22:58
 
Copyright 2007 Fungal Plant Pathology Lab. & FBL
E-mail : yonglee@snu.ac.kr
Magnaporthe oryzae TDNA Database