T-DNA Browser >> T-DNA List >> T-DNA Detail Information
 
T-DNA Name  GOV-493
Reference (Species)  Magnaporthe oryzae 5 CONTIG
Border (Vector / Readthrough)  LB (Minus) (Y)
Copy Number  
Origin Info (ATMT)  
BLAST Search Result (2)  (Magnaporthe grisea 4 CONTIG) [2005-04-23 12:45:06]
 (Not defined) [2006-09-09 17:22:20]
There are 2 detail information.
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.189 : 26164 ~ 26164
Chromosome  5
TTL Info  
Locus Info  MGG_13570.5 (ORF DIS : 420 bp) (ORF Length : 1851 bp)
Near Locus Info  Near : 5' : MGG_13569.5 (2155 bp) (Minus)
 Far   : 3' : MGG_13571.5 (3166 bp) (Minus)
Range of Components
No Type Range Target
1 Border 3 ~ 62 (Plus)   8773 ~ 8832 (Minus)
2 Contig (189) 68 ~ 395 (Plus)   25833 ~ 26159 (Minus)
Sequences [A]
TTAAAACGTCCGCAATGTGTTATTAAGTTGTCTAAGCGTCAATTTGTTTACACCACAATATAACCCTTGCTCGCTGCTAA
TCGGGCTCATTAGAGAGTGAACATAATCCACCTGGTGCCGGGATGGGAATCTGGGATGGGAGAGTAAAGGAAGGGTCGGA
GAGCAGGTTCCATATTTCCTCTTGTCTTGCTGCAAAGTCGTGCCATTTCGCAATTCTTCGGGGGTAAACACGACCGGCAG
GATTAGTCGTGTCGCCTTGGGTGGTAAGAGAACGGTCGGTAAGAACTTGGATGGAAAGACTGAGCGAGTGACAGGCGTCA
AGATAGGGCTCAATTGTCAGCGGTTGTGATGCCCTAGCAGTTTCTTCCGCTTCTTCGCGTCGGCGTTGCTCTTCT
TCGCG
TCGGCGTTGCTCTTCTTCGGCGTCGGCGTTGCTCTTCTTCNNCGTCGGCGTTGCTCTTCTTCNNCGTCGGNGTTGCTCTT
CTTCNNNNNNNGNNTANGNTCNTCNTNNNNNNNNGNNNNNNCNCNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNCNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNN
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.30 : 3452 ~ 3452
Chromosome  Ex
TTL Info  
Locus Info  MGG_14404.5 (ORF DIS : 423 bp) (ORF Length : 2004 bp)
Near Locus Info  Near : 5' : MGG_14403.5 (1705 bp) (Minus)
 Far   : 3' : MGG_14405.5 (3166 bp) (Minus)
Range of Components
No Type Range Target
1 Border 3 ~ 62 (Plus)   8773 ~ 8832 (Minus)
2 Contig (30) 68 ~ 395 (Plus)   3120 ~ 3447 (Minus)
Sequences [B]
TTAAAACGTCCGCAATGTGTTATTAAGTTGTCTAAGCGTCAATTTGTTTACACCACAATATAACCCTTGCTCGCTGCTAA
TCGGGCTCATTAGAGAGTGAACATAATCCACCTGGTGCCGGGATGGGAATCTGGGATGGGAGAGTAAAGGAAGGGTCGGA
GAGCAGGTTCCATATTTCCTCTTGTCTTGCTGCAAAGTCGTGCCATTTCGCAATTCTTCGGGGGTAAACACGACCGGCAG
GATTAGTCGTGTCGCCTTGGGTGGTAAGAGAACGGTCGGTAAGAACTTGGATGGAAAGACTGAGCGAGTGACAGGCGTCA
AGATAGGGCTCAATTGTCAGCGGTTGTGATGCCCTAGCAGTTTCTTCCGCTTCTTCGCGTCGGCGTTGCTCTTCT
TCGCG
TCGGCGTTGCTCTTCTTCGGCGTCGGCGTTGCTCTTCTTCNNCGTCGGCGTTGCTCTTCTTCNNCGTCGGNGTTGCTCTT
CTTCNNNNNNNGNNTANGNTCNTCNTNNNNNNNNGNNNNNNCNCNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNCNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNN
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
Comment  LB-ADM3
KJ201에 778과 1244가 나타남
Create date / Update date  2005-04-23 12:44:57 /
 
Copyright ⓒ 2007 Fungal Plant Pathology Lab. & FBL
E-mail : yonglee@snu.ac.kr
Magnaporthe oryzae TDNA Database