T-DNA Browser >> T-DNA List >> T-DNA Detail Information
 
T-DNA Name  OLU-0851
Reference (Species)  Magnaporthe oryzae 5 CONTIG
Border (Vector / Readthrough)  RB (Plus) (Y)
Copy Number  1
Origin Info (ATMT)  OLU-085 ATMT0138C4
BLAST Search Result (2)  (Magnaporthe grisea 4 CONTIG) [2005-05-06 20:41:56]
 (Not defined) [2006-09-09 17:20:35]
There are 1 detail information.
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.189 : 963715 ~ 963715
Chromosome  5
TTL Info  
Locus Info  MGG_09706.5 (ORF DIS : 958 bp) (ORF Length : 1443 bp)
Near Locus Info  Near : 3' : MGG_13655.5 (2254 bp) (Plus)
 Far   : 5' : MGG_09705.5 (2503 bp) (Plus)
Range of Components
No Type Range Target
1 Border 27 ~ 81 (Plus)   2436 ~ 2489 (Plus)
2 Contig (189) 121 ~ 204 (Plus)   963004 ~ 963087 (Minus)
3 Contig (189) 313 ~ 656 (Plus)   962558 ~ 962900 (Minus)
4 Contig (189) 671 ~ 710 (Plus)   962505 ~ 962544 (Minus)
Sequences [A]
GNGTGGGGGGGGGCTACNTCNGCTTGGAGCTTGGATCANATTGTCGTNTCCCGACCTNCNGTTNAGACTATCANTGTTTG
A
NCNCTACTGGTGTCNTTCGACNNCTCACAGGTGTGGAGAGCTTTGANNANGANGCCGAGCTCNCTCNTCNNCNNAANNA
AGCCTGGNTCGGNCGGNTNNCANTGCAAAATTGGGAGGGACCAA
CTNTATTGTATAATCGTTGCAGCTCAGAAAGACATG
CNATCNCNNGCACCAGNNTAGTTTGAGCCAANTNCCTTANGNANNTACNTAGCNCTTANNTNGCNTCNNNTGGCCTAGTA
AATATCCAATTGAACAGAAGCCCTATTTCGCGTTTTGATCGCCTGCTTCTTTACCCAAGCTACTTTTTCAATTCNTANCA
AATCTTTAACCTGGTCAAAGTCGAAAAAATGACGAGTCCAACTCTAGACCAGGTAGAGTAGAAAAGAACCGTTGCTAGGA
GCTGTCAGACTGTCAGTGTCATTTCCCGACGAGTCATGTGCGTGGTAAACCCGTCCAGCCAGTTCCAAGCAGCTCTCCTC
GNACACCACCATCCCCCCCACCTCCACAGGCCCCTGTCGGTCCNAGCCGGTGGGGCTCTTTTCGCTATTGATCTTCTCTT
CTTTTCCAACAATTGC
TGGNNNNNGNNNNNCTACAACCACNAAGTCAAAGTAGCGGTTTTGTTATTCATCCNNNNNTTTN
CCCNNNANAATGNTNCNAANCTTGNNTNGANNCNNTNAANCAATCNTCNNCAAAACTCNCNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNT
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
Comment  RB-ADM1
Create date / Update date  2005-05-06 20:41:49 /
 
Copyright 2007 Fungal Plant Pathology Lab. & FBL
E-mail : yonglee@snu.ac.kr
Magnaporthe oryzae TDNA Database