T-DNA Browser >> T-DNA List >> T-DNA Detail Information
 
T-DNA Name  A02-B31
Reference (Species)  Magnaporthe oryzae 5 CONTIG
Border (Vector / Readthrough)  RB (Plus) (Y)
Copy Number  Not Exist!
Origin Info (ATMT)  A02-B3 ATMT0232B2
BLAST Search Result (2)  (Magnaporthe grisea 4 CONTIG) [2005-01-26 16:02:04]
 (Not defined) [2006-09-09 17:21:26]
There are 1 detail information.
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.187 : 3012624 ~ 3012624
Chromosome  4
TTL Info  
Locus Info  None (ORF DIS : 0 bp) (ORF Length : bp)
Near Locus Info  Near : 5' : MGG_10131.5 (610 bp) (Minus)
 Far   : 3' : MGG_12239.5 (2600 bp) (Minus)
Range of Components
No Type Range Target
1 Border 16 ~ 59 (Plus)   2430 ~ 2473 (Plus)
2 Contig (187) 60 ~ 311 (Plus)   3012624 ~ 3012875 (Plus)
Sequences [A]
CGGNGGGAGGATAGACAGCTTGAGCTTGGATCAGATTGTCGTTTCCCGCCTTCAGTTTAGTAGTTTAATCTGTAGGTATA
TCCCGGCTAGCCGAGGAGTGGGGAAACCTACCTCCCGATGCACGACGAAGCGTCCCTTGTTGAATTAATGGCACGAGATG
TGGGGGGCCAACCCCGGCACGTGAACAATACGGTATGGGGACGGCTGTGGCTTTGTGGTAGGATCGTCTCCGGGGTAGGT
AGCGGCGCAGTTTGGGCAGCGCCCGATGGCGTGTCCTGATTTTACTGCGAGCTTTGCTGAAAATACTTGCT
CCTTATATT
ACCTTGGCNTACTNCACTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNT
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
Comment  -
Create date / Update date  2005-01-19 09:30:33 /
 
Copyright 2007 Fungal Plant Pathology Lab. & FBL
E-mail : yonglee@snu.ac.kr
Magnaporthe oryzae TDNA Database