T-DNA Browser >> T-DNA List >> T-DNA Detail Information
 
T-DNA Name  PATH-1752
Reference (Species)  Magnaporthe oryzae 5 CONTIG
Border (Vector / Readthrough)  RB (Plus) (Y)
Copy Number  1
Origin Info (ATMT)  Path-175 ATMT0049B2
BLAST Search Result (2)  (Magnaporthe grisea 4 CONTIG) [2005-06-30 16:53:50]
 (Not defined) [2006-09-09 17:20:53]
There are 6 detail information.
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.162 : 23965 ~ 23965
Chromosome  Ex
TTL Info  
Locus Info  None (ORF DIS : 0 bp) (ORF Length : bp)
Near Locus Info  Near : 3' : MGG_08225.5 (1851 bp) (Minus)
 Far   : 3' : MGG_08219.5 (3946 bp) (Plus)
Range of Components
No Type Range Target
1 Border 14 ~ 80 (Plus)   2422 ~ 2489 (Plus)
2 ContigBorder 81 ~ 81 (-)  
3 Contig (162) 82 ~ 208 (Plus)   24478 ~ 24725 (Minus)
4 ContigOverlap 207 ~ 284 (Plus)  
5 Contig (162) 285 ~ 326 (Plus)   24167 ~ 24244 (Minus)
6 ContigOverlap 327 ~ 328 (Plus)  
7 Contig (162) 329 ~ 593 (Plus)   24747 ~ 25013 (Plus)
Sequences [A]
TGGTTNTGGAAGNTGCTAGAGCAGCTTGAGCTTGGATCACATTGTCGTTTCCCGCCTTCAGTTTAAACTATCAGTGTTTG
A
TCTTTTCTTCAGTTGCCAAGGCTGTCCCCAGGGTGGTTGGGTGGGCACAATGTGGTTGTCACCGGAAACAAAGGCGCCA
AAAACAATACGCCCAAAATTCCAACGGATGGTAGGAATATTGTGCCTGGCTCGCACTCTCTGCATGAAAACAAAACAGAA
AGGGCAATGTAATCTCGGGGAGGCCGAGAACAAACACTCGGGAA
GGTGCAGATCCACACAAGAATATCCCAGTTGCGTGC
CGGAAT
GCTACAGACCCATTAGGACTTTCTGGGTGCCAGAATTATTGGGTAAGGGTTATTGTCTTAATGCTTTGTCACAA
GAAAAAGCCCCAATTACACATTTGCTTATCCAGCATTCTTGAAGCCAACCTTTTCATCATTTGCGTATCCATGCCCACTT
TGAGCAAATTCGCCAAACTTATTCTGTTAAAATAGGCAGGTATTTAGGTTTGGTGCCATGATGGCCATCTACTTACTATG
GGCCAAAACGTTACCGTCGGCGCCGATGTCTCC
NGGNNNNNNNNCCCCNNAAANNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.187 : 2456275 ~ 2456275
Chromosome  4
TTL Info  
Locus Info  None (ORF DIS : 0 bp) (ORF Length : bp)
Near Locus Info  Near : 5' : MGG_12202.5 (208 bp) (Minus)
 Far   : 5' : MGG_12203.5 (400 bp) (Plus)
Range of Components
No Type Range Target
1 Border 14 ~ 81 (Plus)   2422 ~ 2489 (Plus)
2 Contig (187) 331 ~ 390 (Plus)   2456524 ~ 2456583 (Plus)
3 Contig (187) 426 ~ 498 (Plus)   2456887 ~ 2456959 (Plus)
Sequences [B]
TGGTTNTGGAAGNTGCTAGAGCAGCTTGAGCTTGGATCACATTGTCGTTTCCCGCCTTCAGTTTAAACTATCAGTGTTTG
A
TCTTTTCTTCAGTTGCCAAGGCTGTCCCCAGGGTGGTTGGGTGGGCACAATGTGGTTGTCACCGGAAACAAAGGCGCCA
AAAACAATACGCCCAAAATTCCAACGGATGGTAGGAATATTGTGCCTGGCTCGCACTCTCTGCATGAAAACAAAACAGAA
AGGGCAATGTAATCTCGGGGAGGCCGAGAACAAACACTCGGGAAGGTGCAGATCCACACAAGAATATCCCAGTTGCGTGC
CGGAATGCTACAGACCCATTAGGACTTTCTGGGTGCCAGAATTATTGGGTAAGGGTTATTGTCTTAATGCTTTGTCACAA
GAAAAAGCCCCAATTACACATTTGCTTATCCAGCATTCTTGAAGCCAACCTTTTCATCATTTGCGTATCCATGCCCACTT
TGAGCAAATTCGCCAAAC
TTATTCTGTTAAAATAGGCAGGTATTTAGGTTTGGTGCCATGATGGCCATCTACTTACTATG
GGCCAAAACGTTACCGTCGGCGCCGATGTCTCCNGGNNNNNNNNCCCCNNAAANNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.100 : 1425 ~ 1425
Chromosome  Ex
TTL Info  
Locus Info  None (ORF DIS : 0 bp) (ORF Length : bp)
Near Locus Info  Near : 5' : MGG_00013.5 (28 bp) (Plus)
 Far   : None : (0 bp) (None)
Range of Components
No Type Range Target
1 Border 14 ~ 81 (Plus)   2422 ~ 2489 (Plus)
2 Contig (100) 207 ~ 284 (Plus)   1224 ~ 1300 (Minus)
Sequences [C]
TGGTTNTGGAAGNTGCTAGAGCAGCTTGAGCTTGGATCACATTGTCGTTTCCCGCCTTCAGTTTAAACTATCAGTGTTTG
A
TCTTTTCTTCAGTTGCCAAGGCTGTCCCCAGGGTGGTTGGGTGGGCACAATGTGGTTGTCACCGGAAACAAAGGCGCCA
AAAACAATACGCCCAAAATTCCAACGGATGGTAGGAATATTGTGCCTGGCTCGCACTCTCTGCATGAAAACAAAACAGAA
AGGGCAATGTAATCTCGGGGAGGCCGAGAACAAACACTCGGGAA
GGTGCAGATCCACACAAGAATATCCCAGTTGCGTGC
CGGAATGCTACAGACCCATTAGGACTTTCTGGGTGCCAGAATTATTGGGTAAGGGTTATTGTCTTAATGCTTTGTCACAA
GAAAAAGCCCCAATTACACATTTGCTTATCCAGCATTCTTGAAGCCAACCTTTTCATCATTTGCGTATCCATGCCCACTT
TGAGCAAATTCGCCAAACTTATTCTGTTAAAATAGGCAGGTATTTAGGTTTGGTGCCATGATGGCCATCTACTTACTATG
GGCCAAAACGTTACCGTCGGCGCCGATGTCTCCNGGNNNNNNNNCCCCNNAAANNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.186 : 1804794 ~ 1804794
Chromosome  2
TTL Info  
Locus Info  None (ORF DIS : 0 bp) (ORF Length : bp)
Near Locus Info  Near : 5' : MGG_11823.5 (172 bp) (Minus)
 Far   : 3' : MGG_06816.5 (2614 bp) (Minus)
Range of Components
No Type Range Target
1 Border 14 ~ 81 (Plus)   2422 ~ 2489 (Plus)
2 Contig (186) 210 ~ 284 (Plus)   1804922 ~ 1804996 (Plus)
Sequences [D]
TGGTTNTGGAAGNTGCTAGAGCAGCTTGAGCTTGGATCACATTGTCGTTTCCCGCCTTCAGTTTAAACTATCAGTGTTTG
A
TCTTTTCTTCAGTTGCCAAGGCTGTCCCCAGGGTGGTTGGGTGGGCACAATGTGGTTGTCACCGGAAACAAAGGCGCCA
AAAACAATACGCCCAAAATTCCAACGGATGGTAGGAATATTGTGCCTGGCTCGCACTCTCTGCATGAAAACAAAACAGAA
AGGGCAATGTAATCTCGGGGAGGCCGAGAACAAACACTCGGGAA
GGTGCAGATCCACACAAGAATATCCCAGTTGCGTGC
CGGAATGCTACAGACCCATTAGGACTTTCTGGGTGCCAGAATTATTGGGTAAGGGTTATTGTCTTAATGCTTTGTCACAA
GAAAAAGCCCCAATTACACATTTGCTTATCCAGCATTCTTGAAGCCAACCTTTTCATCATTTGCGTATCCATGCCCACTT
TGAGCAAATTCGCCAAACTTATTCTGTTAAAATAGGCAGGTATTTAGGTTTGGTGCCATGATGGCCATCTACTTACTATG
GGCCAAAACGTTACCGTCGGCGCCGATGTCTCCNGGNNNNNNNNCCCCNNAAANNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.27 : 8789 ~ 8789
Chromosome  Ex
TTL Info  
Locus Info  None (ORF DIS : 0 bp) (ORF Length : bp)
Near Locus Info  Near : 3' : MGG_14421.5 (1313 bp) (Plus)
 Far   : None : (0 bp) (None)
Range of Components
No Type Range Target
1 Border 14 ~ 81 (Plus)   2422 ~ 2489 (Plus)
2 Contig (27) 227 ~ 284 (Plus)   8587 ~ 8644 (Minus)
Sequences [E]
TGGTTNTGGAAGNTGCTAGAGCAGCTTGAGCTTGGATCACATTGTCGTTTCCCGCCTTCAGTTTAAACTATCAGTGTTTG
A
TCTTTTCTTCAGTTGCCAAGGCTGTCCCCAGGGTGGTTGGGTGGGCACAATGTGGTTGTCACCGGAAACAAAGGCGCCA
AAAACAATACGCCCAAAATTCCAACGGATGGTAGGAATATTGTGCCTGGCTCGCACTCTCTGCATGAAAACAAAACAGAA
AGGGCAATGTAATCTCGGGGAGGCCGAGAACAAACACTCGGGAA
GGTGCAGATCCACACAAGAATATCCCAGTTGCGTGC
CGGAATGCTACAGACCCATTAGGACTTTCTGGGTGCCAGAATTATTGGGTAAGGGTTATTGTCTTAATGCTTTGTCACAA
GAAAAAGCCCCAATTACACATTTGCTTATCCAGCATTCTTGAAGCCAACCTTTTCATCATTTGCGTATCCATGCCCACTT
TGAGCAAATTCGCCAAACTTATTCTGTTAAAATAGGCAGGTATTTAGGTTTGGTGCCATGATGGCCATCTACTTACTATG
GGCCAAAACGTTACCGTCGGCGCCGATGTCTCCNGGNNNNNNNNCCCCNNAAANNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.44 : 3132 ~ 3132
Chromosome  Ex
Locus Info  None (ORF DIS : 0 bp) (ORF Length : bp)
Near Locus Info  Near : 3' : MGG_01956.5 (1750 bp) (Minus)
 Far   : None : (0 bp) (None)
Range of Components
No Type Range Target
1 Border 14 ~ 81 (Plus)   2422 ~ 2489 (Plus)
2 Contig (44) 304 ~ 329 (Plus)   2885 ~ 2910 (Minus)
Sequences [F]
TGGTTNTGGAAGNTGCTAGAGCAGCTTGAGCTTGGATCACATTGTCGTTTCCCGCCTTCAGTTTAAACTATCAGTGTTTG
A
TCTTTTCTTCAGTTGCCAAGGCTGTCCCCAGGGTGGTTGGGTGGGCACAATGTGGTTGTCACCGGAAACAAAGGCGCCA
AAAACAATACGCCCAAAATTCCAACGGATGGTAGGAATATTGTGCCTGGCTCGCACTCTCTGCATGAAAACAAAACAGAA
AGGGCAATGTAATCTCGGGGAGGCCGAGAACAAACACTCGGGAAGGTGCAGATCCACACAAGAATATCCCAGTTGCGTGC
CGGAATGCT
ACAGACCCATTAGGACTTTCTGGGTGCCAGAATTATTGGGTAAGGGTTATTGTCTTAATGCTTTGTCACAA
GAAAAAGCCCCAATTACACATTTGCTTATCCAGCATTCTTGAAGCCAACCTTTTCATCATTTGCGTATCCATGCCCACTT
TGAGCAAATTCGCCAAACTTATTCTGTTAAAATAGGCAGGTATTTAGGTTTGGTGCCATGATGGCCATCTACTTACTATG
GGCCAAAACGTTACCGTCGGCGCCGATGTCTCCNGGNNNNNNNNCCCCNNAAANNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
Comment  RB-AD1 secondary
contig 1910 comes out repeatably
Create date / Update date  2005-06-30 16:53:29 /
 
Copyright 2007 Fungal Plant Pathology Lab. & FBL
E-mail : yonglee@snu.ac.kr
Magnaporthe oryzae TDNA Database