T-DNA Browser >> T-DNA List >> T-DNA Detail Information
 
T-DNA Name  PATH-1941
Reference (Species)  Magnaporthe oryzae 5 CONTIG
Border (Vector / Readthrough)  RB (Plus) (Y)
Copy Number  2
Origin Info (ATMT)  Path-194 ATMT0055C2
BLAST Search Result (2)  (Magnaporthe grisea 4 CONTIG) [2005-07-05 14:18:17]
 (Not defined) [2006-09-09 17:21:18]
There are 1 detail information.
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.189 : 540564 ~ 540564
Chromosome  5
TTL Info  
Locus Info  None (ORF DIS : 0 bp) (ORF Length : bp)
Near Locus Info  Near : 5' : MGG_13617.5 (883 bp) (Minus)
 Far   : 5' : MGG_10001.5 (1635 bp) (Plus)
Range of Components
No Type Range Target
1 Border 12 ~ 80 (Plus)   2421 ~ 2489 (Plus)
2 TDNA 245 ~ 376 (Plus)   8907 ~ 9034 (Plus)
3 Contig (189) 439 ~ 923 (Plus)   540922 ~ 541405 (Plus)
Sequences [A]
GCTGNATGGCGATGCTAGAGCAGCTTGAGCTTGGATCAGATTGTCGTTTCCCGCCTTCAGTTTAAACTATCAGTGTTTGA
NNNNTTATNNTNCNNTGTCGCNGACGTGTGGACAGNTCTAANCCCACTTCATNNTTACCACTGTGGCCGCNATGTTCTCT
NNNGGGTGNAAAGCNTTAANGCCGCNNGTATNCNCGTGNNNANCCNNANTNTTTNNNCNNNANATTTTGGTTGNAGGTGN
TAGAAAATTTTATTGNNANANTTATTTTACAAATACNNATACATACCTAAGGGTTTCTGNATATGCTCAACACATGAGCG
AAACCCGNATAGGAACCCTCNCTTCCCTTANCTGGGANCTACTCACNCATTATTAT
TTCNCNAACTCGAAACTGGTTCCC
GGTCGGCATCTACTCNNTTCNGNNNNANCCTTCACNNACGATCGGCAGGGTGAAGCGCCAGGATTTAACCCTCGACAATT
TATCCCCACAGATTTTTTGCCCAACCAGTCAGATGGCTTGCTCCGGCAGATTCGGCAAAGGAAAATCACCGCTGCAAGCC
ACTAATCCAATTATTACACAGTAACCAAGATTTATGCAAAATGGAGCAGGTATTTGAAAGAGGCAAGTGACCGACGCAAT
CTACAACGTACCCAATCACAGAAAAAGTGTCGGCAATGCTAGCCGAGTGTCTGCGTTTGTTGCACAGTGGTGCANTCAGG
TTAGCGACAGAGCANCGCTTGTTTCAACAGTCNATGGGGCCATGAANCGAGGGAGGACCTTCNTTGTTCTTGGGAAAGTG
TGTGTACCGATCTANTTTTGTCTCCTGCATCCTCNTTATGATTACNTTCCNAGTCCAATTCNATACGGNNACCCANTTCC
CGCAGGATCTGCCCATAAAANAATCTCANTACCTTGNAGGCCC
CCNANCNNNNGNATNCNNNNCCC
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
Comment  RB-AD1 PATH03
secondary PCR products sequenced with RB3 primer
Create date / Update date  2005-07-05 14:18:05 /
 
Copyright 2007 Fungal Plant Pathology Lab. & FBL
E-mail : yonglee@snu.ac.kr
Magnaporthe oryzae TDNA Database