T-DNA Browser >> T-DNA List >> T-DNA Detail Information
 
T-DNA Name  PATH-3511
Reference (Species)  Magnaporthe oryzae 5 CONTIG
Border (Vector / Readthrough)  RB (Plus) (Y)
Copy Number  1
Origin Info (ATMT)  Path-351 ATMT0098C6
BLAST Search Result (2)  (Magnaporthe grisea 4 CONTIG) [2005-07-05 14:19:32]
 (Not defined) [2006-09-09 17:21:59]
There are 2 detail information.
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.186 : 340325 ~ 340325
Chromosome  2
TTL Info  
Locus Info  None (ORF DIS : 0 bp) (ORF Length : bp)
Near Locus Info  Near : 3' : MGG_09901.5 (1391 bp) (Plus)
 Far   : 5' : MGG_09900.5 (1604 bp) (Plus)
Range of Components
No Type Range Target
1 Border 6 ~ 82 (Plus)   2414 ~ 2489 (Plus)
2 Contig (186) 323 ~ 677 (Plus)   339736 ~ 340085 (Minus)
Sequences [A]
CTTGNATGGCGAATGCTAGAAGCAGCTTGAGCTTGGATCAGATTGTCGTTTCCCGCCTTCAGTTTAAACTATCAGTGTTT
GA
ATTTACNGTGGNTNTATAGTCTCCCGATACCTGCCTGCNGCGTANGGACTNNTACNCNAGGTCGGCCAATCTGGCGNG
GTCNGAANCNNGGNNCGTACTNNATTNGATANGGATCCCCCCNCNTGCCCGGCGCAGGGCACATTATCATAATCTTTGCG
CCAGGNNTTNCTCNACTAGGTNCTCTTTANGTNCAACTTTGNGNGANAAANANAAAAANAAAAGAAAAANATCNNCANAN
CNATAACAANNCCACTCCCNAAANCNANAGCCCTACAAGNTGNCTNAANCCNTGGNGGGGAAANTGACATCGCGTTNNAA
AAGCNCCCCCNGGGAANAACCCTCCANCGNCCGGCCCCNTTTGTNATTCTGTCCTGGCTCCCACTGNAAAGANAANAGAG
GAGACAAAGACACGAATTCNCNTCTCACNTCAAAGAGTTGCTGNGANTTNGGCANCCNAGGCAGGCTCCNGACACGCAAC
CCGACTCGAGAAGGGNANNAAGATACCNACACTATGTANAGCCNAGAGCTGATTCGGGCGNCANTATNGTTGCGCGCGTT
TTGTTTCTCGAGAGCGAGGCAGGTAANTTATTTTTCA
CATNTTTTTTNCNCAGATCNNAGGNAGGCCACNACCTNGGAGG
CATATGTTTGAATGGCTGNNGACATCNNACTTGGNNTNCCCCANAANAANAGGANAAACCNTCCNNNGNNNGGACCACCN
GGTACGNCCGGGGNGGAAAAACCCCCCAAAAACNNGGGGNNANATNANCCNAANATNNNGAACCCANAGCNAAAAANNGG
GGGGAAANGGNNANAAANNNAAA
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.189 : 572694 ~ 572694
Chromosome  5
TTL Info  
Locus Info  None (ORF DIS : 0 bp) (ORF Length : bp)
Near Locus Info  Near : 3' : MGG_13619.5 (466 bp) (Plus)
 Far   : 5' : MGG_13620.5 (925 bp) (Plus)
Range of Components
No Type Range Target
1 Border 6 ~ 82 (Plus)   2414 ~ 2489 (Plus)
2 Contig (189) 188 ~ 242 (Plus)   572799 ~ 572853 (Plus)
Sequences [B]
CTTGNATGGCGAATGCTAGAAGCAGCTTGAGCTTGGATCAGATTGTCGTTTCCCGCCTTCAGTTTAAACTATCAGTGTTT
GA
ATTTACNGTGGNTNTATAGTCTCCCGATACCTGCCTGCNGCGTANGGACTNNTACNCNAGGTCGGCCAATCTGGCGNG
GTCNGAANCNNGGNNCGTACTNNATTNGATANGGATCCCCCCNCNTGCCCGGCGCAGGGCACATTATCATAATCTTTGCG
CC
AGGNNTTNCTCNACTAGGTNCTCTTTANGTNCAACTTTGNGNGANAAANANAAAAANAAAAGAAAAANATCNNCANAN
CNATAACAANNCCACTCCCNAAANCNANAGCCCTACAAGNTGNCTNAANCCNTGGNGGGGAAANTGACATCGCGTTNNAA
AAGCNCCCCCNGGGAANAACCCTCCANCGNCCGGCCCCNTTTGTNATTCTGTCCTGGCTCCCACTGNAAAGANAANAGAG
GAGACAAAGACACGAATTCNCNTCTCACNTCAAAGAGTTGCTGNGANTTNGGCANCCNAGGCAGGCTCCNGACACGCAAC
CCGACTCGAGAAGGGNANNAAGATACCNACACTATGTANAGCCNAGAGCTGATTCGGGCGNCANTATNGTTGCGCGCGTT
TTGTTTCTCGAGAGCGAGGCAGGTAANTTATTTTTCACATNTTTTTTNCNCAGATCNNAGGNAGGCCACNACCTNGGAGG
CATATGTTTGAATGGCTGNNGACATCNNACTTGGNNTNCCCCANAANAANAGGANAAACCNTCCNNNGNNNGGACCACCN
GGTACGNCCGGGGNGGAAAAACCCCCCAAAAACNNGGGGNNANATNANCCNAANATNNNGAACCCANAGCNAAAAANNGG
GGGGAAANGGNNANAAANNNAAA
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
Comment  RB-AD1 PATH04
SECONDARY PCR PRODUCTS WERE SEQUENCED WITH RB3 PRIMER
Create date / Update date  2005-07-05 14:19:21 /
 
Copyright 2007 Fungal Plant Pathology Lab. & FBL
E-mail : yonglee@snu.ac.kr
Magnaporthe oryzae TDNA Database