T-DNA Browser >> T-DNA List >> T-DNA Detail Information
 
T-DNA Name  PATH-3701
Reference (Species)  Magnaporthe oryzae 5 CONTIG
Border (Vector / Readthrough)  RB (Plus) (Y)
Copy Number  0
Origin Info (ATMT)  Path-370 ATMT0103A5
BLAST Search Result (2)  (Magnaporthe grisea 4 CONTIG) [2005-07-05 14:19:32]
 (Not defined) [2006-09-09 17:19:40]
There are 1 detail information.
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.187 : 2518675 ~ 2518675
Chromosome  4
TTL Info  
Locus Info  None (ORF DIS : 0 bp) (ORF Length : bp)
Near Locus Info  Near : 5' : MGG_04311.5 (592 bp) (Minus)
 Far   : 5' : MGG_04312.5 (1415 bp) (Plus)
Range of Components
No Type Range Target
1 Border 13 ~ 82 (Plus)   2421 ~ 2490 (Plus)
2 ContigBorder 83 ~ 83 (-)  
3 Contig (187) 84 ~ 631 (Plus)   2518674 ~ 2519218 (Plus)
Sequences [A]
GCTTGNATGGAGATGCTAGAGCAGCTTGAGCTTGGATNATNATTGTCGTTTCCCGCCTTCAGTTTAAACTATCAGTGTTT
GA
CCTGGGCTTGGGTGCTCCCAGAAATGATGGAGGTGTAGGTTGCATGGTTTGGAGTTGCGTNGTGGATGTGGGTTGGGA
GTTTTCTCTCAATGACGTTTACGGTAGAGTGCTATTCTCCCTCTTCAGCTCATCAACTCCCCTTGTATCCCTTCCAGGGG
GCATACCTAAGGTTGCGGGCAAGACGGAGTAGGAGTAGGATTAGATTGGTTCTTGGTCCTCANGCCCTCACCATGTTCAA
AGGTGTACGGCAAATAACGTTGTTAGTTGCAGCACGCCGGGCGCCAACCTATCCCCGCATTCTCGTCGCCTTCGCGACGG
AGCTGTTTCAGGAACAGAAGTTGTGATGCAGCCAGCTAGCGGCGAGATTTAAGTGCCCCTGATATGGCGACTCCCACCTG
GCATGATTCGACGGAGCGAGACAAAGATTGCGTTGGTGGGCGAAGCGAACCTAAAGTGTTCCGAGCGTAGCGTATCCTGA
TATCCCTCATCCTTGTGTTCAATGCTTCAGGGCTTCCTTCTTACTGATGAACCTAAATCGGAGGCTCCACC
NGNNNNNNN
NNNCCCCNNAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNN
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
Comment  RB-AD1 PATH04
SECONDARY PCR PRODUCTS WERE SEQUENCED WITH RB3 PRIMER
Create date / Update date  2005-07-05 14:19:21 /
 
Copyright 2007 Fungal Plant Pathology Lab. & FBL
E-mail : yonglee@snu.ac.kr
Magnaporthe oryzae TDNA Database