T-DNA Browser >> T-DNA List >> T-DNA Detail Information
 
T-DNA Name  PATH-3891
Reference (Species)  Magnaporthe oryzae 5 CONTIG
Border (Vector / Readthrough)  RB (Plus) (Y)
Copy Number  1
Origin Info (ATMT)  Path-389 ATMT0114D1
BLAST Search Result (2)  (Magnaporthe grisea 4 CONTIG) [2005-07-08 09:13:48]
 (Not defined) [2006-09-09 17:21:56]
There are 1 detail information.
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.187 : 2813884 ~ 2813884
Chromosome  4
TTL Info  
Locus Info  None (ORF DIS : 0 bp) (ORF Length : bp)
Near Locus Info  Near : 3' : MGG_10420.5 (379 bp) (Minus)
 Far   : 5' : MGG_10422.5 (7872 bp) (Minus)
Range of Components
No Type Range Target
1 Border 12 ~ 79 (Plus)   2422 ~ 2489 (Plus)
2 ContigBorder 80 ~ 82 (-)  
3 Contig (187) 83 ~ 545 (Plus)   2813423 ~ 2813887 (Minus)
Sequences [A]
TTGTATGGAGNTGCTAGAGCAGCTTGAGCTTGGATCAGATTGTCGTTTTCCCCGCCCTTCAGTTTAAACTATCAGTGTTT
GA
TATAGGCGTCGCAAGTGCTTCCAGAACAGGACCACGGATATCCGGCATTTACCAGATGGGCATGATCGTTGCAATGGG
GTTGCATTGCGGCAGGAAAGCCGTTAACACTCTTATGTTCTGGTTCTTGCCAAAAGAGACTCCAACACNAAGCTCCAGTC
GAGTCCTGTTGATGAACGAGGACCAGGTGGCAGAGGGGGTACAAAAGATTTCTACTGCTGCGTGATGACGAATACAAAAG
TCNAAGCTCCCCTGTCGAAAAGCTACGTAGCCGATATGCTAATGTCAAGCTAAGTCGATCTACGGCCAAGTGCAGATTTT
ATAGGCAGATCTTGAGCCACGTCTTCAACGCTCCTCATTGAAGATCAGGTAGTTTCTACCCTATGAAGGACGCACCATGA
GTGGTTGGCCTGGGAAGCTTCCTCACTCACCTTGCCTGACCTCTTNNTTTCCCCCACTCAGTTGC
NGNNNNNNNNNNNNC
CCCNNAANNNNNNNNNNNNNNAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
Comment  RB-AD1 secondary PATH 05 + GOV + INDEPTH
KJ201 ̻
Create date / Update date  2005-07-08 09:13:34 /
 
Copyright 2007 Fungal Plant Pathology Lab. & FBL
E-mail : yonglee@snu.ac.kr
Magnaporthe oryzae TDNA Database