T-DNA Browser >> T-DNA List >> T-DNA Detail Information
 
T-DNA Name  PATH-4371
Reference (Species)  Magnaporthe oryzae 5 CONTIG
Border (Vector / Readthrough)  RB (Plus) (Y)
Copy Number  1
Origin Info (ATMT)  Path-437 ATMT0127A4
BLAST Search Result (2)  (Magnaporthe grisea 4 CONTIG) [2005-07-08 09:13:48]
 (Not defined) [2006-09-09 17:21:34]
There are 9 detail information.
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.178 : 302463 ~ 302463
Chromosome  3
TTL Info  
Locus Info  None (ORF DIS : 0 bp) (ORF Length : bp)
Near Locus Info  Near : 5' : MGG_06133.5 (267 bp) (Plus)
 Far   : 5' : MGG_06134.5 (1403 bp) (Minus)
Range of Components
No Type Range Target
1 Border 1 ~ 53 (Plus)   2435 ~ 2489 (Plus)
2 ContigBorder 54 ~ 55 (-)  
3 Contig (178) 56 ~ 686 (Plus)   301836 ~ 302465 (Minus)
Sequences [A]
TGAGCTTGGATCANATTGTCGTTTCCCGCCTTCAGTTTAAACTATCAGTGTTTGAGTTCCCGAATAAGAGCAGCCAATAA
TAAGAGTTGTTGGCTCATGGGTCGATTTTGGCTTGGGCTCTTTCCGACTTCCGGCCCACCTTTTCTTTCATATGCAACCC
ACTTCCAAACGATGCTGCCAATTGCTGGTGACGGAGTGGCGGTACTTGCCATGTCAGTACTGTGCGCGTACGATCCGACA
GTCCACATGGGGTGGGGGAGTTGGTGACTGTCGAACTGTGTTATGTTGCCATCGAGTGTTCAGAATGTAATAATTAGCAA
AGTACTACTGTGGCCATTGTCTTGGCTTGCATCCACCACCTCGTGACTTTCCGGATAACTAAATACACGCGATGGCCAAA
ATCGCACTGCAAACTTTAACATTCCATTCGGTAACGATCATTGGTAAAGTTAGCGATGGTCAGCGATCTCGAAATCCACG
TATACTTTATGATATTATAATACATACCTAGGTAGGCTTAAGTAGGCAATCCCTCGCAGTTTGAGATACCCGGTACCTCC
AACTCCGTTTTGTCTAATTGCAGACTCCCCTGGCAAGACCCATACTTATAAAAGATAAACCAATTAAAGGTCGAGGGGCA
CACCGGAGACGCTAATACCGGTACATGCTGGGCCTAATACGACAGT
NACATAAGNCAGNGGGNNCCCNCCCCCCNAAAAN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.184 : 12175 ~ 12175
Chromosome  2
TTL Info  
Locus Info  None (ORF DIS : 0 bp) (ORF Length : bp)
Near Locus Info  Near : 3' : MGG_01948.5 (90 bp) (Plus)
 Far   : 3' : MGG_01949.5 (1131 bp) (Minus)
Range of Components
No Type Range Target
1 Border 1 ~ 55 (Plus)   2435 ~ 2489 (Plus)
2 Contig (184) 441 ~ 469 (Plus)   11762 ~ 11790 (Minus)
Sequences [B]
TGAGCTTGGATCANATTGTCGTTTCCCGCCTTCAGTTTAAACTATCAGTGTTTGAGTTCCCGAATAAGAGCAGCCAATAA
TAAGAGTTGTTGGCTCATGGGTCGATTTTGGCTTGGGCTCTTTCCGACTTCCGGCCCACCTTTTCTTTCATATGCAACCC
ACTTCCAAACGATGCTGCCAATTGCTGGTGACGGAGTGGCGGTACTTGCCATGTCAGTACTGTGCGCGTACGATCCGACA
GTCCACATGGGGTGGGGGAGTTGGTGACTGTCGAACTGTGTTATGTTGCCATCGAGTGTTCAGAATGTAATAATTAGCAA
AGTACTACTGTGGCCATTGTCTTGGCTTGCATCCACCACCTCGTGACTTTCCGGATAACTAAATACACGCGATGGCCAAA
ATCGCACTGCAAACTTTAACATTCCATTCGGTAACGATCATTGGTAAAGTTAGCGATGGTCAGCGATCTCGAAATCCACG
TATACTTTATGATATTATAATACATACCTAGGTAGGCTTAAGTAGGCAATCCCTCGCAGTTTGAGATACCCGGTACCTCC
AACTCCGTTTTGTCTAATTGCAGACTCCCCTGGCAAGACCCATACTTATAAAAGATAAACCAATTAAAGGTCGAGGGGCA
CACCGGAGACGCTAATACCGGTACATGCTGGGCCTAATACGACAGTNACATAAGNCAGNGGGNNCCCNCCCCCCNAAAAN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.190 : 444149 ~ 444149
Chromosome  5
TTL Info  
Locus Info  None (ORF DIS : 0 bp) (ORF Length : bp)
Near Locus Info  Near : 5' : MGG_03271.5 (3 bp) (Plus)
 Far   : 3' : MGG_03272.5 (546 bp) (Plus)
Range of Components
No Type Range Target
1 Border 1 ~ 55 (Plus)   2435 ~ 2489 (Plus)
2 Contig (190) 383 ~ 417 (Plus)   443788 ~ 443822 (Minus)
Sequences [C]
TGAGCTTGGATCANATTGTCGTTTCCCGCCTTCAGTTTAAACTATCAGTGTTTGAGTTCCCGAATAAGAGCAGCCAATAA
TAAGAGTTGTTGGCTCATGGGTCGATTTTGGCTTGGGCTCTTTCCGACTTCCGGCCCACCTTTTCTTTCATATGCAACCC
ACTTCCAAACGATGCTGCCAATTGCTGGTGACGGAGTGGCGGTACTTGCCATGTCAGTACTGTGCGCGTACGATCCGACA
GTCCACATGGGGTGGGGGAGTTGGTGACTGTCGAACTGTGTTATGTTGCCATCGAGTGTTCAGAATGTAATAATTAGCAA
AGTACTACTGTGGCCATTGTCTTGGCTTGCATCCACCACCTCGTGACTTTCCGGATAACTAAATACACGCGATGGCCAAA
ATCGCACTGCAAACTTT
AACATTCCATTCGGTAACGATCATTGGTAAAGTTAGCGATGGTCAGCGATCTCGAAATCCACG
TATACTTTATGATATTATAATACATACCTAGGTAGGCTTAAGTAGGCAATCCCTCGCAGTTTGAGATACCCGGTACCTCC
AACTCCGTTTTGTCTAATTGCAGACTCCCCTGGCAAGACCCATACTTATAAAAGATAAACCAATTAAAGGTCGAGGGGCA
CACCGGAGACGCTAATACCGGTACATGCTGGGCCTAATACGACAGTNACATAAGNCAGNGGGNNCCCNCCCCCCNAAAAN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.190 : 1568795 ~ 1568795
Chromosome  5
TTL Info  
Locus Info  None (ORF DIS : 0 bp) (ORF Length : bp)
Near Locus Info  Near : 5' : MGG_06491.5 (14 bp) (Plus)
 Far   : 5' : MGG_06492.5 (3802 bp) (Minus)
Range of Components
No Type Range Target
1 Border 1 ~ 55 (Plus)   2435 ~ 2489 (Plus)
2 Contig (190) 384 ~ 417 (Plus)   1568434 ~ 1568467 (Minus)
Sequences [D]
TGAGCTTGGATCANATTGTCGTTTCCCGCCTTCAGTTTAAACTATCAGTGTTTGAGTTCCCGAATAAGAGCAGCCAATAA
TAAGAGTTGTTGGCTCATGGGTCGATTTTGGCTTGGGCTCTTTCCGACTTCCGGCCCACCTTTTCTTTCATATGCAACCC
ACTTCCAAACGATGCTGCCAATTGCTGGTGACGGAGTGGCGGTACTTGCCATGTCAGTACTGTGCGCGTACGATCCGACA
GTCCACATGGGGTGGGGGAGTTGGTGACTGTCGAACTGTGTTATGTTGCCATCGAGTGTTCAGAATGTAATAATTAGCAA
AGTACTACTGTGGCCATTGTCTTGGCTTGCATCCACCACCTCGTGACTTTCCGGATAACTAAATACACGCGATGGCCAAA
ATCGCACTGCAAACTTT
AACATTCCATTCGGTAACGATCATTGGTAAAGTTAGCGATGGTCAGCGATCTCGAAATCCACG
TATACTTTATGATATTATAATACATACCTAGGTAGGCTTAAGTAGGCAATCCCTCGCAGTTTGAGATACCCGGTACCTCC
AACTCCGTTTTGTCTAATTGCAGACTCCCCTGGCAAGACCCATACTTATAAAAGATAAACCAATTAAAGGTCGAGGGGCA
CACCGGAGACGCTAATACCGGTACATGCTGGGCCTAATACGACAGTNACATAAGNCAGNGGGNNCCCNCCCCCCNAAAAN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.193 : 1519389 ~ 1519389
Chromosome  7
TTL Info  
Locus Info  None (ORF DIS : 0 bp) (ORF Length : bp)
Near Locus Info  Near : 5' : MGG_02769.5 (191 bp) (Minus)
 Far   : 5' : MGG_02767.5 (4878 bp) (Plus)
Range of Components
No Type Range Target
1 Border 1 ~ 55 (Plus)   2435 ~ 2489 (Plus)
2 Contig (193) 384 ~ 417 (Plus)   1519717 ~ 1519750 (Plus)
Sequences [E]
TGAGCTTGGATCANATTGTCGTTTCCCGCCTTCAGTTTAAACTATCAGTGTTTGAGTTCCCGAATAAGAGCAGCCAATAA
TAAGAGTTGTTGGCTCATGGGTCGATTTTGGCTTGGGCTCTTTCCGACTTCCGGCCCACCTTTTCTTTCATATGCAACCC
ACTTCCAAACGATGCTGCCAATTGCTGGTGACGGAGTGGCGGTACTTGCCATGTCAGTACTGTGCGCGTACGATCCGACA
GTCCACATGGGGTGGGGGAGTTGGTGACTGTCGAACTGTGTTATGTTGCCATCGAGTGTTCAGAATGTAATAATTAGCAA
AGTACTACTGTGGCCATTGTCTTGGCTTGCATCCACCACCTCGTGACTTTCCGGATAACTAAATACACGCGATGGCCAAA
ATCGCACTGCAAACTTT
AACATTCCATTCGGTAACGATCATTGGTAAAGTTAGCGATGGTCAGCGATCTCGAAATCCACG
TATACTTTATGATATTATAATACATACCTAGGTAGGCTTAAGTAGGCAATCCCTCGCAGTTTGAGATACCCGGTACCTCC
AACTCCGTTTTGTCTAATTGCAGACTCCCCTGGCAAGACCCATACTTATAAAAGATAAACCAATTAAAGGTCGAGGGGCA
CACCGGAGACGCTAATACCGGTACATGCTGGGCCTAATACGACAGTNACATAAGNCAGNGGGNNCCCNCCCCCCNAAAAN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.189 : 490898 ~ 490898
Chromosome  5
TTL Info  
Locus Info  None (ORF DIS : 0 bp) (ORF Length : bp)
Near Locus Info  Near : 3' : MGG_10012.5 (637 bp) (Plus)
 Far   : 5' : MGG_10011.5 (1407 bp) (Plus)
Range of Components
No Type Range Target
1 Border 1 ~ 55 (Plus)   2435 ~ 2489 (Plus)
2 Contig (189) 384 ~ 417 (Plus)   491226 ~ 491259 (Plus)
Sequences [F]
TGAGCTTGGATCANATTGTCGTTTCCCGCCTTCAGTTTAAACTATCAGTGTTTGAGTTCCCGAATAAGAGCAGCCAATAA
TAAGAGTTGTTGGCTCATGGGTCGATTTTGGCTTGGGCTCTTTCCGACTTCCGGCCCACCTTTTCTTTCATATGCAACCC
ACTTCCAAACGATGCTGCCAATTGCTGGTGACGGAGTGGCGGTACTTGCCATGTCAGTACTGTGCGCGTACGATCCGACA
GTCCACATGGGGTGGGGGAGTTGGTGACTGTCGAACTGTGTTATGTTGCCATCGAGTGTTCAGAATGTAATAATTAGCAA
AGTACTACTGTGGCCATTGTCTTGGCTTGCATCCACCACCTCGTGACTTTCCGGATAACTAAATACACGCGATGGCCAAA
ATCGCACTGCAAACTTT
AACATTCCATTCGGTAACGATCATTGGTAAAGTTAGCGATGGTCAGCGATCTCGAAATCCACG
TATACTTTATGATATTATAATACATACCTAGGTAGGCTTAAGTAGGCAATCCCTCGCAGTTTGAGATACCCGGTACCTCC
AACTCCGTTTTGTCTAATTGCAGACTCCCCTGGCAAGACCCATACTTATAAAAGATAAACCAATTAAAGGTCGAGGGGCA
CACCGGAGACGCTAATACCGGTACATGCTGGGCCTAATACGACAGTNACATAAGNCAGNGGGNNCCCNCCCCCCNAAAAN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.189 : 413580 ~ 413580
Chromosome  5
TTL Info  
Locus Info  None (ORF DIS : 0 bp) (ORF Length : bp)
Near Locus Info  Near : 3' : MGG_10035.5 (861 bp) (Plus)
 Far   : 5' : MGG_10034.5 (1443 bp) (Plus)
Range of Components
No Type Range Target
1 Border 1 ~ 55 (Plus)   2435 ~ 2489 (Plus)
2 Contig (189) 384 ~ 417 (Plus)   413908 ~ 413941 (Plus)
Sequences [G]
TGAGCTTGGATCANATTGTCGTTTCCCGCCTTCAGTTTAAACTATCAGTGTTTGAGTTCCCGAATAAGAGCAGCCAATAA
TAAGAGTTGTTGGCTCATGGGTCGATTTTGGCTTGGGCTCTTTCCGACTTCCGGCCCACCTTTTCTTTCATATGCAACCC
ACTTCCAAACGATGCTGCCAATTGCTGGTGACGGAGTGGCGGTACTTGCCATGTCAGTACTGTGCGCGTACGATCCGACA
GTCCACATGGGGTGGGGGAGTTGGTGACTGTCGAACTGTGTTATGTTGCCATCGAGTGTTCAGAATGTAATAATTAGCAA
AGTACTACTGTGGCCATTGTCTTGGCTTGCATCCACCACCTCGTGACTTTCCGGATAACTAAATACACGCGATGGCCAAA
ATCGCACTGCAAACTTT
AACATTCCATTCGGTAACGATCATTGGTAAAGTTAGCGATGGTCAGCGATCTCGAAATCCACG
TATACTTTATGATATTATAATACATACCTAGGTAGGCTTAAGTAGGCAATCCCTCGCAGTTTGAGATACCCGGTACCTCC
AACTCCGTTTTGTCTAATTGCAGACTCCCCTGGCAAGACCCATACTTATAAAAGATAAACCAATTAAAGGTCGAGGGGCA
CACCGGAGACGCTAATACCGGTACATGCTGGGCCTAATACGACAGTNACATAAGNCAGNGGGNNCCCNCCCCCCNAAAAN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.182 : 820248 ~ 820248
Chromosome  5
TTL Info  
Locus Info  None (ORF DIS : 0 bp) (ORF Length : bp)
Near Locus Info  Near : 3' : MGG_08589.5 (408 bp) (Plus)
 Far   : 5' : MGG_08590.5 (621 bp) (Plus)
Range of Components
No Type Range Target
1 Border 1 ~ 55 (Plus)   2435 ~ 2489 (Plus)
2 Contig (182) 384 ~ 417 (Plus)   819887 ~ 819920 (Minus)
Sequences [H]
TGAGCTTGGATCANATTGTCGTTTCCCGCCTTCAGTTTAAACTATCAGTGTTTGAGTTCCCGAATAAGAGCAGCCAATAA
TAAGAGTTGTTGGCTCATGGGTCGATTTTGGCTTGGGCTCTTTCCGACTTCCGGCCCACCTTTTCTTTCATATGCAACCC
ACTTCCAAACGATGCTGCCAATTGCTGGTGACGGAGTGGCGGTACTTGCCATGTCAGTACTGTGCGCGTACGATCCGACA
GTCCACATGGGGTGGGGGAGTTGGTGACTGTCGAACTGTGTTATGTTGCCATCGAGTGTTCAGAATGTAATAATTAGCAA
AGTACTACTGTGGCCATTGTCTTGGCTTGCATCCACCACCTCGTGACTTTCCGGATAACTAAATACACGCGATGGCCAAA
ATCGCACTGCAAACTTT
AACATTCCATTCGGTAACGATCATTGGTAAAGTTAGCGATGGTCAGCGATCTCGAAATCCACG
TATACTTTATGATATTATAATACATACCTAGGTAGGCTTAAGTAGGCAATCCCTCGCAGTTTGAGATACCCGGTACCTCC
AACTCCGTTTTGTCTAATTGCAGACTCCCCTGGCAAGACCCATACTTATAAAAGATAAACCAATTAAAGGTCGAGGGGCA
CACCGGAGACGCTAATACCGGTACATGCTGGGCCTAATACGACAGTNACATAAGNCAGNGGGNNCCCNCCCCCCNAAAAN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.175 : 336757 ~ 336757
Chromosome  3
Locus Info  None (ORF DIS : 0 bp) (ORF Length : bp)
Near Locus Info  Near : 5' : MGG_05239.5 (56 bp) (Plus)
 Far   : 5' : MGG_12905.5 (3572 bp) (Minus)
Range of Components
No Type Range Target
1 Border 1 ~ 55 (Plus)   2435 ~ 2489 (Plus)
2 Contig (175) 441 ~ 465 (Plus)   336348 ~ 336372 (Minus)
Sequences [I]
TGAGCTTGGATCANATTGTCGTTTCCCGCCTTCAGTTTAAACTATCAGTGTTTGAGTTCCCGAATAAGAGCAGCCAATAA
TAAGAGTTGTTGGCTCATGGGTCGATTTTGGCTTGGGCTCTTTCCGACTTCCGGCCCACCTTTTCTTTCATATGCAACCC
ACTTCCAAACGATGCTGCCAATTGCTGGTGACGGAGTGGCGGTACTTGCCATGTCAGTACTGTGCGCGTACGATCCGACA
GTCCACATGGGGTGGGGGAGTTGGTGACTGTCGAACTGTGTTATGTTGCCATCGAGTGTTCAGAATGTAATAATTAGCAA
AGTACTACTGTGGCCATTGTCTTGGCTTGCATCCACCACCTCGTGACTTTCCGGATAACTAAATACACGCGATGGCCAAA
ATCGCACTGCAAACTTTAACATTCCATTCGGTAACGATCATTGGTAAAGTTAGCGATGGTCAGCGATCTCGAAATCCACG
TATACTTTATGATATTATAATACATACCTAGGTAGGCTTAAGTAGGCAATCCCTCGCAGTTTGAGATACCCGGTACCTCC
AACTCCGTTTTGTCTAATTGCAGACTCCCCTGGCAAGACCCATACTTATAAAAGATAAACCAATTAAAGGTCGAGGGGCA
CACCGGAGACGCTAATACCGGTACATGCTGGGCCTAATACGACAGTNACATAAGNCAGNGGGNNCCCNCCCCCCNAAAAN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
Comment  RB-AD1 secondary PATH 05 + GOV + INDEPTH
KJ201 ̻
Create date / Update date  2005-07-08 09:13:34 /
 
Copyright 2007 Fungal Plant Pathology Lab. & FBL
E-mail : yonglee@snu.ac.kr
Magnaporthe oryzae TDNA Database