T-DNA Browser >> T-DNA List >> T-DNA Detail Information
 
T-DNA Name  GOV-517
Reference (Species)  Magnaporthe oryzae 5 CONTIG
Border (Vector / Readthrough)  LB (Minus) (Y)
Copy Number  
Origin Info (ATMT)  
BLAST Search Result (2)  (Magnaporthe grisea 4 CONTIG) [2005-11-07 11:26:43]
 (Not defined) [2006-09-09 17:21:33]
There are 1 detail information.
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.189 : 681071 ~ 681071
Chromosome  5
TTL Info  
Locus Info  None (ORF DIS : 0 bp) (ORF Length : bp)
Near Locus Info  Near : 5' : MGG_09966.5 (593 bp) (Minus)
 Far   : 5' : MGG_09965.5 (694 bp) (Plus)
Range of Components
No Type Range Target
1 Border 24 ~ 75 (Plus)   8768 ~ 8820 (Minus)
2 ContigBorder 76 ~ 76 (-)  
3 Contig (189) 77 ~ 846 (Plus)   680294 ~ 681072 (Minus)
Sequences [A]
TAACCGTATGCGGCTGACGTCGCATGTGTTATTAAGTTGTCTAAGCGTCAATTTGTTTACACCACAATATATCCTGGAGG
GGCAGGGGAAGAATTGGGGGGGATAATGTACTCTAATAGTAATCCCGTCAAAACAACAAAGCAACCCACCCGCTAGGGAA
ACGGGAGTCGATATCCGAGACGAACCCTTGGCAAGCTTTCGTTGTCAACGCCTTCCGGAAGCCTTATGAAAGTGAAACAA
GAAAACGTCAAATGTGGTGGCTGATTGAACTTGTCACTCAGAGGATATACACGACAGAAATACCACAAAGAAAGGGCACG
TTTCAACAGAGAAAGCCGCCGACTGGGTCAGCTGGGCGGACAGTGCTGTGCTATACTGTAAAATGATCGTTGACTGTTTG
GTCACCGACAGTCTGTCCAGTCATTCTTGAGGGGGGGCTTTGTGGAGTTCGTGGAGTCGGAGCGGCGGTGCAGACCAAAT
CGATCGAATTTCCCAAGTGGAAAGTGGGGTCTTTTGTTGAGAATGGAGAAAAGAGTAAAATTCGAAATAAAAAAAAGGAA
GAAGCGGTCTGTCCTTTGCGACTGTTGCCAGCTGCAAAAGAGTCAAATGGACAAGGTTGGAGGCCGGTCGGCAGCAGTTC
ACAGCAGCATCGTCATGTGTCGAACACCCATGGATGCCAATCTCGTACGTGTGTGTCTGCTGCTGCAGGTAGGAAATTCC
CGGAATTGGAGAGCAGAGCTCATGGTCGGTTCCAGACGCGATGCCAGAAGAAAGGGGTAAAGCTCTCAAAGAGAAACAGA
TGGCTGCTGCGCAAAACCCAGTCAGTCACTCACTGTTATAGCCATG

Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
Comment  -
Create date / Update date  2005-11-07 11:26:41 /
 
Copyright 2007 Fungal Plant Pathology Lab. & FBL
E-mail : yonglee@snu.ac.kr
Magnaporthe oryzae TDNA Database