T-DNA Browser >> T-DNA List >> T-DNA Detail Information
 
T-DNA Name  0009D51
Reference (Species)  Magnaporthe oryzae 5 CONTIG
Border (Vector / Readthrough)  LB (Minus) (Y)
Copy Number  Not Exist!
Origin Info (ATMT)  ATMT0009D5
BLAST Search Result (2)  (Not defined) [2006-02-27 16:28:11]
 (Not defined) [2006-09-09 17:21:59]
There are 1 detail information.
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.189 : 637199 ~ 637199
Chromosome  5
TTL Info  
Locus Info  MGG_09979.5 (ORF DIS : 1530 bp) (ORF Length : 1356 bp)
Near Locus Info  Near : 3' : MGG_09978.5 (138 bp) (Minus)
 Far   : 3' : MGG_13628.5 (3428 bp) (Plus)
Range of Components
No Type Range Target
1 Border 24 ~ 69 (Plus)   8774 ~ 8820 (Minus)
2 ContigBorder 70 ~ 70 (-)  
3 Contig (189) 71 ~ 782 (Plus)   637198 ~ 637916 (Plus)
Sequences [A]
CATCGCACCCCTGCCTGAGTCGCATGTGTTATTAAGTTGTCTAAGCGTCAATTTGTTTACACCACAATATGTGGGTCATC
AAGGATACTAGACTTAAATCTCCAAGTCTATGATTCTACACATCTAGTATAAACTCCAGTTTTACTTTTTAGATGATTTC
TAAAACGCTCCAGATATTAGTACAATCCCGAGAGAGGGAACAAAGCCCTTAGAGGAAGTTGACGCCAACGCCAAACTGCA
GGCCTTTCCTGCTCTCCTCGCCCATCCTCATCACCAGCGGCAGGCTAAAGTTCAACTCGAACCTAGCGACCGGGTGCGCA
TACACCAGTCCGACACCAGCCGACATGCTGGGCAGGCCGGTGATCAAGTCGCCAAACGCGCTCTTCATGCCTCGGAAGAC
TGCACCAGCCTCCATGCCCGAAAACAATTTGTTTTCTCTCCTGTCCTTGAAGACGACCATGCGACCACCGATGGCAAAAA
TTTGGAGACGTAGCGGTGAGTCCGGCCCGGTCTTGGGGACAGGCAGAAGCATGTTGACACCGGCGGCGGCATACACATAT
CCACCGACGGCATCCGCGCCATCCCTGGGCCCAGACCACCGATCTTGAAACCACGAACATCGGGTGGCCCGCCAAGCTGG
AAGCGGTCGTTGATCCTGCTGGGAAGTGCCCTGCTCGAGAGAGATACTCCAGCGGCAGAGGGTAGAGCATACCCTCTTGG
ATACTGCACCGTATGAATTTCTGTCTTCTTGCTGTTCAGCCAGGTACGTGACCGGCACAGCG

Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
Comment  LB AAD6 3
Create date / Update date  2006-02-27 16:28:02 /
 
Copyright 2007 Fungal Plant Pathology Lab. & FBL
E-mail : yonglee@snu.ac.kr
Magnaporthe oryzae TDNA Database