T-DNA Browser >> T-DNA List >> T-DNA Detail Information
 
T-DNA Name  A01-B22
Reference (Species)  Magnaporthe oryzae 5 CONTIG
Border (Vector / Readthrough)  RB (Plus) (Y)
Copy Number  3
Origin Info (ATMT)  A01-B2 ATMT0096A2
BLAST Search Result (2)  (Magnaporthe grisea 4 CONTIG) [2005-01-26 16:10:19]
 (Not defined) [2006-09-09 17:20:39]
There are 1 detail information.
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.189 : 400676 ~ 400676
Chromosome  5
TTL Info  
Locus Info  MGG_10039.5 (ORF DIS : 2978 bp) (ORF Length : 1632 bp)
Near Locus Info  Near : 3' : MGG_10038.5 (799 bp) (Minus)
 Far   : 3' : MGG_13603.5 (3373 bp) (Plus)
Range of Components
No Type Range Target
1 Border 14 ~ 73 (Plus)   2424 ~ 2489 (Plus)
2 ContigBorder 74 ~ 73 (-)  
3 Undefined 74 ~ 78 (-)  
4 Undefined 79 ~ 78 (-)  
5 Undefined 79 ~ 79 (-)  
6 Contig (30) (Dup) 80 ~ 79 (Plus)   10217 ~ 10272 (Plus)
7 ContigOverlap (Dup) 80 ~ 79 (Plus)  
8 ContigOverlap 80 ~ 80 (Plus)  
9 ContigOverlap (Dup) 81 ~ 80 (Plus)  
10 ContigOverlap 81 ~ 81 (Plus)  
11 ContigOverlap (Dup) 82 ~ 81 (Plus)  
12 Contig (187) (Dup) 82 ~ 81 (Plus)   613393 ~ 613601 (Plus)
13 ContigOverlap 82 ~ 82 (Plus)  
14 ContigOverlap 83 ~ 83 (Plus)  
15 ContigOverlap 84 ~ 85 (Plus)  
16 Contig (165) (Dup) 84 ~ 85 (Plus)   15827 ~ 16035 (Minus)
17 Contig (126) (Dup) 84 ~ 83 (Plus)   32598 ~ 32630 (Minus)
18 ContigOverlap (Dup) 86 ~ 85 (Plus)  
19 ContigOverlap 86 ~ 87 (Plus)  
20 ContigOverlap (Dup) 88 ~ 87 (Plus)  
21 ContigOverlap 88 ~ 88 (Plus)  
22 Contig (9) (Dup) 88 ~ 90 (Plus)   3455 ~ 3529 (Minus)
23 Contig (189) 88 ~ 88 (Plus)   157994 ~ 158035 (Minus)
24 ContigOverlap 89 ~ 93 (Plus)  
25 ContigOverlap 94 ~ 99 (Plus)  
26 ContigOverlap 100 ~ 111 (Plus)  
27 ContigOverlap 112 ~ 112 (Plus)  
28 ContigOverlap (Dup) 112 ~ 114 (Plus)  
29 Contig (187) (Dup) 112 ~ 114 (Plus)   2968994 ~ 2969057 (Plus)
30 ContigOverlap 113 ~ 114 (Plus)  
31 ContigOverlap (Dup) 115 ~ 120 (Plus)  
32 Contig (127) 115 ~ 120 (Plus)   6964 ~ 7136 (Minus)
33 ContigOverlap (Dup) 115 ~ 118 (Plus)  
34 ContigOverlap 119 ~ 122 (Plus)  
35 ContigOverlap (Dup) 123 ~ 125 (Plus)  
36 ContigOverlap (Dup) 123 ~ 127 (Plus)  
37 ContigOverlap 126 ~ 127 (Plus)  
38 ContigOverlap 128 ~ 129 (Plus)  
39 ContigOverlap (Dup) 128 ~ 136 (Plus)  
40 Contig (182) 128 ~ 136 (Plus)   384884 ~ 385574 (Minus)
41 Contig (187) 130 ~ 136 (Plus)   2922380 ~ 2922542 (Minus)
42 ContigOverlap 130 ~ 129 (Plus)  
43 ContigOverlap (Dup) 130 ~ 136 (Plus)  
44 ContigOverlap (Dup) 130 ~ 134 (Plus)  
45 Contig (125) (Dup) 130 ~ 134 (Plus)   37349 ~ 37564 (Plus)
46 ContigOverlap 135 ~ 149 (Plus)  
47 ContigOverlap (Dup) 150 ~ 173 (Plus)  
48 ContigOverlap 150 ~ 166 (Plus)  
49 ContigOverlap 150 ~ 160 (Plus)  
50 ContigOverlap 150 ~ 172 (Plus)  
51 Contig (18) (Dup) 173 ~ 173 (Plus)   1835 ~ 1923 (Minus)
52 ContigOverlap (Dup) 173 ~ 173 (Plus)  
53 ContigOverlap (Dup) 174 ~ 175 (Plus)  
54 Contig (184) 176 ~ 219 (Plus)   274943 ~ 275057 (Plus)
55 ContigOverlap (Dup) 176 ~ 175 (Plus)  
56 ContigOverlap 176 ~ 182 (Plus)  
57 ContigOverlap 183 ~ 184 (Plus)  
58 ContigOverlap (Dup) 183 ~ 219 (Plus)  
59 ContigOverlap 183 ~ 214 (Plus)  
60 ContigOverlap 183 ~ 217 (Plus)  
61 ContigOverlap (Dup) 185 ~ 217 (Plus)  
62 ContigOverlap (Dup) 185 ~ 214 (Plus)  
63 ContigOverlap (Dup) 185 ~ 219 (Plus)  
64 ContigOverlap (Dup) 215 ~ 217 (Plus)  
65 ContigOverlap (Dup) 215 ~ 219 (Plus)  
66 Contig (183) 215 ~ 217 (Plus)   422530 ~ 422662 (Plus)
67 ContigOverlap 218 ~ 219 (Plus)  
68 ContigOverlap (Dup) 220 ~ 222 (Plus)  
69 ContigOverlap 220 ~ 220 (Plus)  
70 ContigOverlap 221 ~ 230 (Plus)  
71 ContigOverlap 231 ~ 235 (Plus)  
72 Contig (18) 231 ~ 238 (Plus)   1751 ~ 1818 (Plus)
73 ContigOverlap (Dup) 231 ~ 238 (Plus)  
74 ContigOverlap 236 ~ 235 (Plus)  
75 ContigOverlap (Dup) 236 ~ 238 (Plus)  
76 ContigOverlap 239 ~ 238 (Plus)  
77 ContigOverlap (Dup) 239 ~ 240 (Plus)  
78 ContigOverlap (Dup) 241 ~ 240 (Plus)  
79 ContigOverlap 241 ~ 245 (Plus)  
80 Contig (175) (Dup) 241 ~ 245 (Plus)   1797082 ~ 1797131 (Minus)
81 ContigOverlap (Dup) 246 ~ 247 (Plus)  
82 Contig (195) 248 ~ 253 (Plus)   2991604 ~ 2991646 (Plus)
83 ContigOverlap 248 ~ 253 (Plus)  
84 ContigOverlap (Dup) 254 ~ 253 (Plus)  
85 ContigOverlap 254 ~ 279 (Plus)  
86 ContigOverlap 280 ~ 284 (Plus)  
87 ContigOverlap (Dup) 280 ~ 287 (Plus)  
88 Contig (193) (Dup) 280 ~ 287 (Plus)   2228551 ~ 2229078 (Minus)
89 ContigOverlap 280 ~ 285 (Plus)  
90 Contig (9) 286 ~ 285 (Plus)   3346 ~ 3392 (Minus)
91 ContigOverlap 286 ~ 285 (Plus)  
92 ContigOverlap (Dup) 286 ~ 287 (Plus)  
93 ContigOverlap (Dup) 288 ~ 287 (Plus)  
94 ContigOverlap 288 ~ 288 (Plus)  
95 ContigOverlap (Dup) 289 ~ 290 (Plus)  
96 ContigOverlap (Dup) 289 ~ 291 (Plus)  
97 Contig (192) (Dup) 289 ~ 288 (Plus)   8046 ~ 8199 (Minus)
98 ContigOverlap (Dup) 289 ~ 288 (Plus)  
99 ContigOverlap 289 ~ 289 (Plus)  
100 Contig (182) (Dup) 289 ~ 291 (Plus)   379285 ~ 379394 (Minus)
101 Contig (200) 290 ~ 291 (Plus)   1462571 ~ 1462608 (Plus)
102 ContigOverlap (Dup) 290 ~ 289 (Plus)  
103 Contig (178) (Dup) 291 ~ 291 (Plus)   1497423 ~ 1497456 (Minus)
104 ContigOverlap (Dup) 292 ~ 291 (Plus)  
105 ContigOverlap 292 ~ 292 (Plus)  
106 ContigOverlap 293 ~ 293 (Plus)  
107 ContigOverlap 294 ~ 316 (Plus)  
108 Contig (195) (Dup) 294 ~ 324 (Plus)   2975578 ~ 2975611 (Minus)
109 ContigOverlap (Dup) 294 ~ 293 (Plus)  
110 ContigOverlap 317 ~ 321 (Plus)  
111 ContigOverlap (Dup) 317 ~ 324 (Plus)  
112 ContigOverlap 317 ~ 322 (Plus)  
113 ContigOverlap (Dup) 322 ~ 324 (Plus)  
114 ContigOverlap (Dup) 322 ~ 322 (Plus)  
115 ContigOverlap (Dup) 323 ~ 322 (Plus)  
116 ContigOverlap (Dup) 323 ~ 324 (Plus)  
117 Contig (184) 323 ~ 324 (Plus)   283023 ~ 283056 (Plus)
118 Contig (9) 323 ~ 322 (Plus)   3346 ~ 3376 (Minus)
119 ContigOverlap (Dup) 325 ~ 324 (Plus)  
120 ContigOverlap 325 ~ 325 (Plus)  
121 ContigOverlap (Dup) 326 ~ 325 (Plus)  
122 Contig (189) (Dup) 326 ~ 327 (Plus)   173295 ~ 173333 (Minus)
123 ContigOverlap (Dup) 326 ~ 327 (Plus)  
124 ContigOverlap 326 ~ 326 (Plus)  
125 ContigOverlap (Dup) 327 ~ 326 (Plus)  
126 ContigOverlap (Dup) 327 ~ 328 (Plus)  
127 Contig (187) 327 ~ 328 (Plus)   2926105 ~ 2926144 (Minus)
128 Contig (184) (Dup) 328 ~ 328 (Plus)   283023 ~ 283056 (Plus)
129 ContigOverlap 329 ~ 328 (Plus)  
130 ContigOverlap (Dup) 329 ~ 329 (Plus)  
131 ContigOverlap 330 ~ 330 (Plus)  
132 ContigOverlap 331 ~ 353 (Plus)  
133 Contig (195) (Dup) 331 ~ 363 (Plus)   2975577 ~ 2975611 (Minus)
134 Contig (9) 331 ~ 364 (Plus)   3341 ~ 3376 (Minus)
135 ContigOverlap (Dup) 331 ~ 330 (Plus)  
136 ContigOverlap (Dup) 354 ~ 737 (Plus)  
137 ContigOverlap (Dup) 354 ~ 362 (Plus)  
138 ContigOverlap 354 ~ 370 (Plus)  
139 ContigOverlap 354 ~ 556 (Plus)  
140 ContigOverlap 354 ~ 366 (Plus)  
141 ContigOverlap 354 ~ 727 (Plus)  
142 ContigOverlap 354 ~ 361 (Plus)  
143 ContigOverlap (Dup) 354 ~ 359 (Plus)  
144 ContigOverlap 354 ~ 736 (Plus)  
145 ContigOverlap 354 ~ 358 (Plus)  
146 ContigOverlap (Dup) 354 ~ 781 (Plus)  
147 ContigOverlap (Dup) 354 ~ 364 (Plus)  
148 ContigOverlap (Dup) 354 ~ 363 (Plus)  
149 ContigOverlap (Dup) 354 ~ 365 (Plus)  
150 ContigOverlap 354 ~ 367 (Plus)  
151 ContigOverlap 354 ~ 506 (Plus)  
152 ContigOverlap (Dup) 359 ~ 359 (Plus)  
153 Contig (59) 359 ~ 363 (Plus)   4033 ~ 4066 (Plus)
154 Contig (187) 359 ~ 365 (Plus)   637673 ~ 637712 (Plus)
155 ContigOverlap (Dup) 359 ~ 362 (Plus)  
156 ContigOverlap 359 ~ 398 (Plus)  
157 ContigOverlap 359 ~ 366 (Plus)  
158 ContigOverlap 359 ~ 365 (Plus)  
159 ContigOverlap 359 ~ 737 (Plus)  
160 ContigOverlap 359 ~ 425 (Plus)  
161 ContigOverlap (Dup) 359 ~ 363 (Plus)  
162 ContigOverlap 359 ~ 779 (Plus)  
163 ContigOverlap (Dup) 359 ~ 781 (Plus)  
164 ContigOverlap (Dup) 359 ~ 364 (Plus)  
165 ContigOverlap 359 ~ 556 (Plus)  
166 ContigOverlap 359 ~ 571 (Plus)  
167 ContigOverlap 359 ~ 475 (Plus)  
168 Contig (195) 364 ~ 364 (Plus)   2991613 ~ 2991647 (Plus)
Sequences [A]
TGGGNNGGAGGTNCTAGANCAGCTTGAGCTTGGATCANATTGCCGTTTCCCGCCTTCTGTTTAAACTATCAGNGTTTGAT
A
TGTCACGGCCNGGCATACATTGGAGAACCTCAGTGTNTTAGGCGCTATCGACNAAAATTCTAAACTGANGAGAAGAGAG
NAATTA
CAATCG
T
CGACGCGCTCAAGAGACGCGCTTAAATCCGGAGGTAGTGGATCCTTGTCCGATCCCTGGCTCGGTGT
GGAGC
CGAGTCGNGATTCTGAGGGTAGGTCTAGGGGCCTGATCCTCACGTGATTCTGAGGGTAGGTCTAGGGGCCTGATC
C
TCA
CGTGATTCTGAGGGTAGGTCTAGGGGCCTGATCCTCACATTTACCCCCCTCTAAGGCCTGATCGACGTAGGCGGTC
AGAGTCTTGAGTCTGTTACGTGTGT
CTCCTCGGGGCCTTCCTCCGCTCTCGTGTCTTTTTCGCATCGTGCTCGGC
AACAT
TGTCCTCGGGTCCGTCCTCCGCAAAA
ACATCCTTTGCTGCGCTCCTGATCCACTGTTGCAAATTTACCGGAGGTCC
TGCT
GCGTCCGGGTA
CTCCCTGTGAAAGGTATCCAGCAGTACTGGTGAATTTTTCAAGTCGCGGGGCCTCATACCATGTCTCAT
CAGGGTCGAGTCCGACCCACGATACCTGATATTGCAACGTCTTCTTTCGTCCGAATAGACGTGAGGCCAACACTTGCTCC
NCCTCCC
ACTCCGGTT
C
NCNTTNANTTCNACCNGGGGNTCCGGCTTTTNATACTGNTGA
GG
NAAGGGACCNNTTNCNNCN
TNNGCANNCGGNNGGGGGGGAAAACNTNCCNCCTTTNNNCCNGGNGGGGGGGCNANAANNAANNTTNGCCCTTTTCCCCN
NAAANNNCNNGGGCCC
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
Comment  AADM
Create date / Update date  2005-01-20 14:45:19 /
 
Copyright 2007 Fungal Plant Pathology Lab. & FBL
E-mail : yonglee@snu.ac.kr
Magnaporthe oryzae TDNA Database