T-DNA Browser >> T-DNA List >> T-DNA Detail Information
 
T-DNA Name  0008D61
Reference (Species)  Magnaporthe oryzae 5 CONTIG
Border (Vector / Readthrough)  None (Y)
Copy Number  Not Exist!
Origin Info (ATMT)  ATMT0008D6
BLAST Search Result (2)  (Not defined) [2006-02-27 16:28:11]
 (Not defined) [2006-09-09 17:21:29]
There are 2 detail information.
     
Locus Info  None (ORF DIS : 0 bp) (ORF Length : bp)
Near Locus Info  Near : None : (0 bp) (None)
 Far   : None : (0 bp) (None)
Range of Components
No Type Range Target
1 Contig (193) 71 ~ 222 (Plus)   846634 ~ 846788 (Plus)
2 ContigTDNA 223 ~ 225 (-)  
3 TDNA 226 ~ 247 (Plus)   9063 ~ 9087 (Plus)
Sequences [A]
TAAAAAACGACCGGTTGAGTCGCATGTGTATTAAGCCTCCGACTCTATGATTCTACACTACCACAATATATCATTTACCT
TTTCTTCTTGATCAGATCACGCTACACCACTTGCATGCGAACGCCCATTTTTCTCTTGGCACTACGCAGGGCACACACAT
ACGCATCAAACTGCCGGAGGCTGTGAAGCAGATCTTGTCTTTATTATGGAGCTAATATGGTG
CTACTCTATTTCTTTGCC
CTCGGAC
TGTCAGGACTGAATCGATCTCAGCCATATCGGAATCGATCTCAGCCATACCGGAATCAATCTCACCCATATCG
GAATCGATCTCATCCATATCGGAATCGATCTCACCCATATCGGAATCCCTCTCCCCCATATCGGAATCGATCTCTCCCAT
ATTGGAAAATATCTCTCCCCCATCGGAAGAGATCTCATCCATATTGGAATAAATCTCTCCCATACCGAAAACGACCCCCG
CCCCATCTGAGCCAATCTCACCCAAATGGGAAAAAATCTCACCCCTATGAAAAACAATCTCTGCCATGTGTGAAAATACT
GCCCCATATCGGTAGAGCCCACACCCACACCCGAGGAGACCCTGCACACTAAAGAAAAAAAAGACCCCCAAATGATAAGA
AACCTCGGCGCACCCGAAGTGACCCCCCCCACATAAGGAGGGATAATCCCCGAAGAAGGGAGATCGCCTTCGTAGAAGGG
AGCTCCCCGGCGGGGATAAAAGAAGCACCTCCTAGGTATATGAATCGCCCCCACCGCATCAGATTA
Genome context
Number of overlapped contigs
 
 
     
Locus Info  None (ORF DIS : 0 bp) (ORF Length : bp)
Near Locus Info  Near : None : (0 bp) (None)
 Far   : None : (0 bp) (None)
Range of Components
No Type Range Target
1 TDNA 223 ~ 241 (Plus)   9063 ~ 9087 (Plus)
2 ContigTDNA 242 ~ 247 (-)  
3 Contig (196) 248 ~ 264 (Plus)   3543903 ~ 3543925 (Plus)
Sequences [B]
TAAAAAACGACCGGTTGAGTCGCATGTGTATTAAGCCTCCGACTCTATGATTCTACACTACCACAATATATCATTTACCT
TTTCTTCTTGATCAGATCACGCTACACCACTTGCATGCGAACGCCCATTTTTCTCTTGGCACTACGCAGGGCACACACAT
ACGCATCAAACTGCCGGAGGCTGTGAAGCAGATCTTGTCTTTATTATGGAGCTAATATGGTGCTACTCTATTTCTTTGCC
C
TCGGACTGTCAGGACTGAATCGATCTCAGCCATATCGGAATCGATCTCAGCCATACCGGAATCAATCTCACCCATATCG
GAATCGATCTCATCCATATCGGAATCGATCTCACCCATATCGGAATCCCTCTCCCCCATATCGGAATCGATCTCTCCCAT
ATTGGAAAATATCTCTCCCCCATCGGAAGAGATCTCATCCATATTGGAATAAATCTCTCCCATACCGAAAACGACCCCCG
CCCCATCTGAGCCAATCTCACCCAAATGGGAAAAAATCTCACCCCTATGAAAAACAATCTCTGCCATGTGTGAAAATACT
GCCCCATATCGGTAGAGCCCACACCCACACCCGAGGAGACCCTGCACACTAAAGAAAAAAAAGACCCCCAAATGATAAGA
AACCTCGGCGCACCCGAAGTGACCCCCCCCACATAAGGAGGGATAATCCCCGAAGAAGGGAGATCGCCTTCGTAGAAGGG
AGCTCCCCGGCGGGGATAAAAGAAGCACCTCCTAGGTATATGAATCGCCCCCACCGCATCAGATTA
Genome context
Number of overlapped contigs
 
 
Comment  LB AAD6 3
Create date / Update date  2006-02-27 16:28:02 /
 
Copyright 2007 Fungal Plant Pathology Lab. & FBL
E-mail : yonglee@snu.ac.kr
Magnaporthe oryzae TDNA Database