T-DNA Browser >> T-DNA List >> T-DNA Detail Information
 
T-DNA Name  0009A21
Reference (Species)  Magnaporthe oryzae 5 CONTIG
Border (Vector / Readthrough)  LB (Minus) (Y)
Copy Number  Not Exist!
Origin Info (ATMT)  ATMT0009A2
BLAST Search Result (2)  (Not defined) [2006-02-27 16:28:09]
 (Not defined) [2006-09-09 17:19:59]
There are 1 detail information.
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.196 : 456879 ~ 456879
Chromosome  1
TTL Info  
Locus Info  None (ORF DIS : 0 bp) (ORF Length : bp)
Near Locus Info  Near : 3' : MGG_01778.5 (642 bp) (Minus)
 Far   : 5' : MGG_01779.5 (1345 bp) (Minus)
Range of Components
No Type Range Target
1 Border 23 ~ 70 (Plus)   8768 ~ 8820 (Minus)
2 ContigBorder 71 ~ 75 (-)  
3 Contig (196) 76 ~ 709 (Plus)   456874 ~ 457518 (Plus)
4 Contig (196) 750 ~ 782 (Plus)   457572 ~ 457604 (Plus)
Sequences [A]
AAAAAAACGCCGCCTGCGTCGCATGTGTTATTAAGTTGTCTAAGCGTCAATTTGTTTACACCACAATATATCCTGGGGTA
GACATTCAGCTAGATCCACATACTAGTCTAGTGATGGGCTTTGTTAGGTATAAACGGATATAACGGCTTCTACAGCACAC
GCCAAACAAATCCGATGTTGGGCTTGGCAGCTACCTATATATACATGTGGGATTGCAACTCGAGGCGGGGAAAAGCGGTA
TCCTTCTCGTAGATACAAGCTACTCTGGACTCTATAAAATGCCACTAGATCGATTCTGGACAAGTTTTTGCAAAGTCGGC
CTTGGTGGCAGCCCAGTATCAAATGGCTATGTAAGCCAACAAGCCTAAGCCACGATGCTGAGTAAGGCCCCAATCCACCC
CACCTGGCCCAGGTGAGCTCCATGACAAGCTGCATATCAATGTAACCACTTTGTCTTTCTAATGGCTTAGTTTCACGAGG
TCAGTGATTTGTAACTCGTAGTAATTATTACCATTACCATTCATTATTGCTGCCACTTTTGCCATCCTTGTATTCATTAT
TTAGAATGCTGGAATATATAATATGTAGCTTACAAAAGATAGAGATGCTCCTAGCGGGCCCTGAGGCGCATACATTTAAT
GAGATGGGAGCTGAAGTGACATCGCTGTATAGTCTATAGATGAGCAGCATCAGCCTGATATGTCTGGGT
CTCATGCTGCT
TGAGCTGCAACTTCGATCTCTGGCTATGTCCCTCTGCTGCTTCTCTGGACCCCTGGGGTGAG
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
Comment  LB AAD6 3
Create date / Update date  2006-02-27 16:28:02 /
 
Copyright 2007 Fungal Plant Pathology Lab. & FBL
E-mail : yonglee@snu.ac.kr
Magnaporthe oryzae TDNA Database