T-DNA Browser >> T-DNA List >> T-DNA Detail Information
 
T-DNA Name  0009A31
Reference (Species)  Magnaporthe oryzae 5 CONTIG
Border (Vector / Readthrough)  LB (Minus) (Y)
Copy Number  Not Exist!
Origin Info (ATMT)  ATMT0009A3
BLAST Search Result (2)  (Not defined) [2006-02-27 16:28:11]
 (Not defined) [2006-09-09 17:19:54]
There are 1 detail information.
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.175 : 1340973 ~ 1340973
Chromosome  3
TTL Info  
Locus Info  None (ORF DIS : 0 bp) (ORF Length : bp)
Near Locus Info  Near : 3' : MGG_04966.5 (1215 bp) (Minus)
 Far   : 3' : MGG_04967.5 (1448 bp) (Plus)
Range of Components
No Type Range Target
1 Border 24 ~ 65 (Plus)   8776 ~ 8820 (Minus)
2 ContigBorder 66 ~ 67 (-)  
3 Contig (175) 68 ~ 200 (Plus)   1340841 ~ 1340975 (Minus)
Sequences [A]
AAAAAAACGCCGCCTGCGTCCGCATGTGTTATTAGTTGTCTAAGCGTCAATTTGTTTACACCACAATGTTTTAAGGCGCT
GCACCCCCTCCCAACTTGTCTTGATAGAAGTATTGCGCTGTGCCTTGACTTGAAAATGATGATACCAGTTGATACCGCAA
GGCATAATTGCGTATAGAGGCGTGCAAAAATGGGACGATG
AAAAAAAAAAATGGGACCCAAAAAGGGTTTACTTAACAAT
TTTCACCCCAAAAAACGGGAAAAAAAAAAAAGTCAAAAAGGGAAAGAAAGGGAAAAAAAAAAAAAAAAAAATGGATTCCC
GGCCAATTTTTACCCCCCACGGGGTTTTCAAATTTTTGTTGGGCCCTTTTCGGCGCCGAAATTTTCCCTTTAAACCCGGG
GGTAATACAAGGTTCTTTTCCCCCCCAAACACAAAAAATTTTCTTTTTTTTCAAAACTGGCCCCAATACAAATTTCCAAA
AAAAGTTTTTGCAAAGTTTTTTAAAAAAAAAAACCCCCCCAAGGCCTTGAAAAATTTTTGAAAGCCTGGGAGGAAAAAAA
AAAGGGTCCGGTAAAAAGCTTTTCCCCGGTTCAAAACCAACCCCCCAAAAGGGGTAAAATCCTTTTTATTGGCCCCCCCC
CCTTGTAACCACCAACCTGGGACTCCTTGGAGAGAAAGGCAAATGTTCCTGGCTTTTTAAAAAAAATGCTGCTTGTCCTA
GCCAAAAAAATCTTCCGCGAGAAAAGGTAAAACAATGGAAACATTTCTATCTCTAGTATACCCCTGTTTGA
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
Comment  LB AAD6 3
Create date / Update date  2006-02-27 16:28:02 /
 
Copyright 2007 Fungal Plant Pathology Lab. & FBL
E-mail : yonglee@snu.ac.kr
Magnaporthe oryzae TDNA Database