T-DNA Browser >> T-DNA List >> T-DNA Detail Information
 
T-DNA Name  0009A51
Reference (Species)  Magnaporthe oryzae 5 CONTIG
Border (Vector / Readthrough)  LB (Minus) (Y)
Copy Number  Not Exist!
Origin Info (ATMT)  ATMT0009A5
BLAST Search Result (2)  (Not defined) [2006-02-27 16:28:09]
 (Not defined) [2006-09-09 17:20:35]
There are 1 detail information.
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.186 : 2433195 ~ 2433195
Chromosome  2
TTL Info  
Locus Info  None (ORF DIS : 0 bp) (ORF Length : bp)
Near Locus Info  Near : 5' : MGG_06653.5 (368 bp) (Minus)
 Far   : 5' : MGG_06652.5 (3459 bp) (Plus)
Range of Components
No Type Range Target
1 Border 20 ~ 68 (Plus)   8768 ~ 8820 (Minus)
2 ContigBorder 69 ~ 72 (-)  
3 Contig (186) 73 ~ 161 (Plus)   2433414 ~ 2433506 (Minus)
4 Contig (186) 253 ~ 430 (Plus)   2433145 ~ 2433322 (Minus)
Sequences [A]
CCGAAAAAAAAACGTCCGCATGTGTTATTAAGTTGTCTAAGCGTCAATTTGTTTACACCACAATATATCCTGATTGAAGT
TGTAACACTAGGTAGACTAGTATGCAGCGGCCTGTTCCAAAGCCCATCACACGTCACGCCCATTTCCATCTGGACAAACA
T
CCCCCCCTTTTTTTCTTTTTTCTTTCTATGGTTCCTCCCAACAAGAACTACTTTTACGGCTCTGCTAGGGTTTGATATC
GGTACAACAGGGTTTGGGTGCCCTCTTCCTCGACAAAGGAGACGGTGGAGTAAACGGGGCTGCTGTCACGGGTCTAAACC
CTCACACCCCTACTGATTATCTTGATGTTTCAAGCATCCCACTATATACCCCTGCCCGGCGCCCGCCATGGAGGCCTCTG
ATGAGGCTGTCTCTAATTTGGTGATTCTTG
TTCAATTTGCTTAACTCTTTTTAAACCCCTAAATATTAAAACCATCCCCT
C
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
Comment  LB AAD6 3
Create date / Update date  2006-02-27 16:28:02 /
 
Copyright 2007 Fungal Plant Pathology Lab. & FBL
E-mail : yonglee@snu.ac.kr
Magnaporthe oryzae TDNA Database