T-DNA Browser >> T-DNA List >> T-DNA Detail Information
 
T-DNA Name  0009A61
Reference (Species)  Magnaporthe oryzae 5 CONTIG
Border (Vector / Readthrough)  LB (Minus) (Y)
Copy Number  Not Exist!
Origin Info (ATMT)  ATMT0009A6
BLAST Search Result (2)  (Not defined) [2006-02-27 16:28:11]
 (Not defined) [2006-09-09 17:21:18]
There are 1 detail information.
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.178 : 488330 ~ 488330
Chromosome  3
TTL Info  
Locus Info  MGG_06074.5 (ORF DIS : 647 bp) (ORF Length : 168 bp)
Near Locus Info  Near : 5' : MGG_13219.5 (2551 bp) (Plus)
 Far   : 3' : MGG_06075.5 (3010 bp) (Plus)
Range of Components
No Type Range Target
1 Border 30 ~ 70 (Plus)   8772 ~ 8812 (Minus)
2 Contig (178) 236 ~ 635 (Plus)   488495 ~ 488892 (Plus)
3 Contig (178) 662 ~ 775 (Plus)   488919 ~ 489030 (Plus)
Sequences [A]
TTTAAACCCCGAGAAAGTCCGCATGTGTTTTAAGTTGTCTAAGCGTCAATTTGTTTACACCCCAATATATATTTACCTTT
TTTTCTTGATCGAACCACCCTCAACTTATTATCTGGAAAATCCCTTTTTTCTCTTGGCGTTATTTGTGTCACCCGCTGGG
ACCCAACACGGCCGCACGCCGATGAGTCCATCTAGCCTTGTTAACGTCACCTCTAGGCTGGTTCTCTATTGCTTTGGATG
TGATGAGTGGCTTGGAGTACGTTGTTTCTTTTTTGTTCCTACAATAATTACCTGACCTGCTTGACCTCTAAGGTGAAGTC
CAAAAGGTCGGAGCTTGGCTGGGATCTTCGAGTGACTGCCAAAACATGGTACGATGCTCCCTCGGAACAGCTACCCCGTA
ATGTGCCCCGTTCTTTGGTGTAAATATTTGGTGTCGATGACGCTGCTACGGGTACAGCTGATGACCTCCGCACCACCTTC
GACAATGGGAAAAGACGCCGCGCGGAGTCTCGGCACACTATAATTTCCCCAGCCAGCCAGTGCATGCGTCAGGCTCCAAA
GTTTATAAAAAAATCCATTTCATTGAACGGAGCGCTAGTGTCCTCTATAGCTGCAGTCACCCGTACCCGGTGTGC
AGAGA
GACCGGAGAGAGAGCGAGAGAATAAACGCTGAATGTTGGGCAAACGCCTCTGTACCGGATAGGACGAGCGTGGCAAACAG
TGTGGTGCGACCTTCATACAAATCAAATGTTCACACTTGTACGGAGTTCTTATTT
TCGT
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
Comment  LB AAD6 3
Create date / Update date  2006-02-27 16:28:02 /
 
Copyright 2007 Fungal Plant Pathology Lab. & FBL
E-mail : yonglee@snu.ac.kr
Magnaporthe oryzae TDNA Database