T-DNA Browser >> T-DNA List >> T-DNA Detail Information
 
T-DNA Name  0009B21
Reference (Species)  Magnaporthe oryzae 5 CONTIG
Border (Vector / Readthrough)  LB (Minus) (Y)
Copy Number  Not Exist!
Origin Info (ATMT)  ATMT0009B2
BLAST Search Result (2)  (Not defined) [2006-02-27 16:28:08]
 (Not defined) [2006-09-09 17:21:02]
There are 1 detail information.
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.187 : 945316 ~ 945316
Chromosome  4
TTL Info  
Locus Info  None (ORF DIS : 0 bp) (ORF Length : bp)
Near Locus Info  Near : 3' : MGG_03870.5 (1185 bp) (Plus)
 Far   : 3' : MGG_12078.5 (2855 bp) (Minus)
Range of Components
No Type Range Target
1 Border 25 ~ 75 (Plus)   8770 ~ 8820 (Minus)
2 Contig (187) 110 ~ 769 (Plus)   944619 ~ 945282 (Minus)
Sequences [A]
AAAAAAACGCCGAATTGCGTCCGCATGTGTTATTAAGTTGTCTAAGCGTCAATTTGTTTACACCACAATATATCCAACCC
TCTTTTTTTCTTCTCTTCTTTTTTTTTACCATGCCAACATTTGTTCCCTCAACCATGTGTAAACTTTGTGCTTTAAAATT
TCCCTTTCGGTTATTGCCAAGCGTACCGCCCCGTCTTTTGGGATAGAAAACAGTCCAATCCTCCACGTTGTGTACCACAA
TCTAAATAGGGGTGCTGAGTTTAACGTGCTTTTGTGCCTGACTGTCCCATGGGGATGAACGTACCCTGCTTGCCTAGCTT
GACCACCATCGACACAATTTGCTATACAATAGCAAAGGTAGCTAGCTACCGGGATGACCTTTTTTCCCCCCCGATTTTGA
TTTTCTCCTAGTGCTCTAGTCACAGTCCGGGGAAACTAGGTGCCAAGCTGCACTGCCCACCTCTTACCTCTAGCCAGGCG
TCTAGCTCAAAGAAAAGACAAAAAAACACACAACACCTGCCAAGGCTGTAAGGCTGTGACGGCGCGAGGCGCCATGACAT
CACTGGGGACGACGGACGCCATGACGGACGTCGCGTTCGCTAGGGGGGGGTGTCTTTTCATCCTTATTCTGCTTTTTTTT
TACTACCTCCCGAGCTAAAGTATTTTGGGGGGAAAAAAAAAAGGGAAGGCGCATTTAAGGCGTTATGCGAATTCATGCAT
CAAGGCGCGATCTGGACATACATCACCGCAAAAAATCGTGGAATCGCGC
CTCCATTAGCACGA
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
Comment  LB AAD6 3
Create date / Update date  2006-02-27 16:28:02 /
 
Copyright 2007 Fungal Plant Pathology Lab. & FBL
E-mail : yonglee@snu.ac.kr
Magnaporthe oryzae TDNA Database