T-DNA Browser >> T-DNA List >> T-DNA Detail Information
 
T-DNA Name  0009B51
Reference (Species)  Magnaporthe oryzae 5 CONTIG
Border (Vector / Readthrough)  LB (Minus) (Y)
Copy Number  Not Exist!
Origin Info (ATMT)  ATMT0009B5
BLAST Search Result (2)  (Not defined) [2006-02-27 16:28:11]
 (Not defined) [2006-09-09 17:20:53]
There are 1 detail information.
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.175 : 1450781 ~ 1450781
Chromosome  3
TTL Info  
Locus Info  None (ORF DIS : 0 bp) (ORF Length : bp)
Near Locus Info  Near : 5' : MGG_04929.5 (734 bp) (Plus)
 Far   : 3' : MGG_04931.5 (3515 bp) (Plus)
Range of Components
No Type Range Target
1 Border 23 ~ 71 (Plus)   8770 ~ 8820 (Minus)
2 ContigBorder 72 ~ 73 (-)  
3 Contig (175) 74 ~ 542 (Plus)   1450779 ~ 1451249 (Plus)
Sequences [A]
AAAAAAACGCCGCCTGCGTCGCATGTGTTATTAAGTTGTCTAAGCGTCAATTTGTTTACACCACAATATATCCAGGAAGT
TACCACCACCTCCCGAATTTGACAAGGGAATGGGTTCTCTTCCGGACGCCGTGGTGAATGCGAGGTGGATATGGAGGACG
CTTTTCTGTCTTTCGTCACCCCTTCCGGTGAACATCCTCAATATTACTTTTGTCGGACCGCATCCATGCTTGGCACTGGC
AACAATTGGTCTCTCTGCTGCTCCGCTACCGCGTTGAGAAAAAACCACCGCAATCCTCCATTGTTGTTCTTGGACCACAA
CCGGCATCTATCCTCCTCCGTAGCCTTTTCGACGCATGTCTCTTAGATCCTACCGTACATGACTGGGATCAGCAAAGACC
CTATAACCAGTCGGGCTTGAACCTAGAGCAAAGAGACGCTTCCGCCTCGAACTCACCAACACGCCATTCACCCCGACCTG
ACCTTCCTTGTCATTGAGCCCGTCAGGTGTAAAACAAACAACCGTTCTTCATCTTCTATGCT
AACTACACTATAATGCCA
TTTAAGACTTCCCCAAGTGTTCTTCAGTCATCTCAGATTCCTTCTCTTACACAAAGAATATACTGGAAGTTATACCACAC
CCGATTTGACTAGAAGAGAGTTCTCTTCGGAAGCCGTGGAGAAGCCAGTGGATATGGAAGAAGCTTTTCGACTTTCGACC
ACTCTCGCTCAACATCCCAGAATACATTGTCAGAAGTATCTGACTGGACTTCACATTGGGGATTCTGCTGGTTCGCCCCG
CGTTACTAAA
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
Comment  LB AAD6 3
Create date / Update date  2006-02-27 16:28:02 /
 
Copyright 2007 Fungal Plant Pathology Lab. & FBL
E-mail : yonglee@snu.ac.kr
Magnaporthe oryzae TDNA Database