T-DNA Browser >> T-DNA List >> T-DNA Detail Information
 
T-DNA Name  0009B61
Reference (Species)  Magnaporthe oryzae 5 CONTIG
Border (Vector / Readthrough)  LB (Minus) (Y)
Copy Number  Not Exist!
Origin Info (ATMT)  ATMT0009B6
BLAST Search Result (2)  (Not defined) [2006-02-27 16:28:09]
 (Not defined) [2006-09-09 17:21:15]
There are 1 detail information.
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.194 : 3601942 ~ 3601942
Chromosome  6
TTL Info  
Locus Info  None (ORF DIS : 0 bp) (ORF Length : bp)
Near Locus Info  Near : 5' : MGG_00158.5 (1959 bp) (Plus)
 Far   : 5' : MGG_00160.5 (3621 bp) (Minus)
Range of Components
No Type Range Target
1 Border 9 ~ 58 (Plus)   8771 ~ 8820 (Minus)
2 Contig (194) 93 ~ 209 (Plus)   3601976 ~ 3602092 (Plus)
3 Contig (194) 222 ~ 637 (Plus)   3602105 ~ 3602524 (Plus)
Sequences [A]
TACGTCGCATGTGTTATTAAGTTGTCTAAGCGTCAATTTGTTTACACCACAATATATCAGGTACTTTGCTTCCTGAACCA
AACACACTACACCTGGATGTTGCGGGCCGAGGGTGGTTCACGGGCACATTGTTCCTTATATACATATCTTTATCTACGAC
CGACCTAGCTTGGGTAACCGCGCCTATATCATGTATCCTGGAAATGGAA
ACCCGATTTCTTTGGAAAAGGAGGGCGTAAA
AATGGCTTCACGAGGAGCTCATTAACTCTAGCAGTTGCAGCCGAGGAGATACATCAAGACAATTGTTGTGGGACAGAAGT
TGTATATTGGAGAAGTCTCGCATATGGTGCAATTGTGCAACGCTGCAACGATGAGAGAGTTTCGTGCCATGACTTGATTC
GACGAGCCCGCGTAACAAACCACAACGTTTTTACACGAACCATACCAGAACAAGACAAAAGCGGAGGTATTCCAGCCCAC
AAAAGGCAAATTTCATGGCAGATGTCAAACATTATGCCGCTACAGGAGCTGGGTGCTAGGCTCTTTTACATTTTGTGCTC
TATCGACTCGGTTTTTATTATAGCGTAGTATACACAGATACTCATGTATCAGTATCATCTCAGACTCGTCAGTTCTG
CTA
GTAGCCGTATCTACAGTGAGTAGCTAATATGCTTTACGAGACGCTCTCCTATCATCAGGTCGAAAGCTGACCAACAGACT
ATGCTGTATGATGATT
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
Comment  LB AAD6 3
Create date / Update date  2006-02-27 16:28:02 /
 
Copyright 2007 Fungal Plant Pathology Lab. & FBL
E-mail : yonglee@snu.ac.kr
Magnaporthe oryzae TDNA Database