T-DNA Browser >> T-DNA List >> T-DNA Detail Information
 
T-DNA Name  0009C11
Reference (Species)  Magnaporthe oryzae 5 CONTIG
Border (Vector / Readthrough)  LB (Minus) (Y)
Copy Number  Not Exist!
Origin Info (ATMT)  ATMT0009C1
BLAST Search Result (2)  (Not defined) [2006-02-27 16:28:08]
 (Not defined) [2006-09-09 17:21:33]
There are 1 detail information.
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.196 : 1902597 ~ 1902597
Chromosome  1
TTL Info  
Locus Info  None (ORF DIS : 0 bp) (ORF Length : bp)
Near Locus Info  Near : 5' : MGG_01377.5 (101 bp) (Plus)
 Far   : 5' : MGG_01378.5 (1031 bp) (Minus)
Range of Components
No Type Range Target
1 Border 24 ~ 70 (Plus)   8770 ~ 8820 (Minus)
2 ContigBorder 71 ~ 74 (-)  
3 Contig (196) 75 ~ 219 (Plus)   1901803 ~ 1901951 (Minus)
4 Contig (196) 467 ~ 721 (Plus)   1901302 ~ 1901554 (Minus)
Sequences [A]
CAAAAAAACGCCGCCAGCGTCGCATGTGTTATTAAGTTGTCTAAGCGTCAATTTGTTTACACCACAATATATCCAGAGAC
CAATTCTAGCTGCTTTGAACTGCTTACCATCTTGTGCAAGCTCAGTTCGGAGCAATTACCTCTCTGCTGCGGTGCATTTT
TACTTGCCGCATCTTTGTATTGTGTTATCTTTGCGCGAGTTATTTGATTCGTTCATATC
TTTTTTTTTTCTATCTCCCCC
CCCCCCTCATTTTTTTGAGGTTGTCTCAAATTTTCCAAAACTTGGCCCCCCCACTTTTTATCATTTTTCCCCCCCCCCCT
TTTACCTTACCCAGCGCCCCACAAACTGCTTTTCAAAAAAAAATTTCTCTCTACAAAAACCTTCGGCTGGGCTCAAAAAA
ACCCGGGTTTCCAATTTCCCCTTACAAGGAAAATTTTTCCAAGGGCCATCCAAAAGGGGGGGAGCGGGAGCTAACAATTT
CAATTCCCTCCGGGGACAGGTGCGCCGAACCACAAACCAAAACTCCCACCCTGTGAAGAAAAACCATGATCCGGCTCAGA
ACTTATTTGTCTATTTTAGCACCTCCCATCCTTCCCTCCATCCGTATCATGGAGCTCAACAGTCTTACAGACCCCCTCAA
TACCCAAAAATGCCCATCAAGGCATGCTGCGGGCTGCTCCTGAAATAAGGGAGTCTATCATTCACGCGACTCCATCTCCG
C
TGGTAGACGGCTGCAACACACCCTGAGTTCCCGCCACGCCCAGGGAAAAAAAAAAAAAAAAAA
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
Comment  LB AAD6 3
Create date / Update date  2006-02-27 16:28:02 /
 
Copyright 2007 Fungal Plant Pathology Lab. & FBL
E-mail : yonglee@snu.ac.kr
Magnaporthe oryzae TDNA Database