T-DNA Browser >> T-DNA List >> T-DNA Detail Information
 
T-DNA Name  0009C31
Reference (Species)  Magnaporthe oryzae 5 CONTIG
Border (Vector / Readthrough)  None (N)
Copy Number  2
Origin Info (ATMT)  ATMT0009C3
BLAST Search Result (2)  (Not defined) [2006-02-27 16:28:11]
 (Not defined) [2006-09-09 17:19:37]
There are 1 detail information.
     
Locus Info  None (ORF DIS : 0 bp) (ORF Length : bp)
Near Locus Info  Near : None : (0 bp) (None)
 Far   : None : (0 bp) (None)
Range of Components
No Type Range Target
1 Contig (187) 84 ~ 452 (Plus)   1576378 ~ 1576748 (Plus)
2 Contig (187) 520 ~ 786 (Plus)   1575587 ~ 1575852 (Minus)
Sequences [A]
TATAAAACGCCTGAAAAACGTCCGCATGTGTTATTAGGTGTCTAACCGTCTCTTTGTTTACCTGGTGAGGGGCGTCGCTG
CTGGACATGTCTGGCACTGATTCTAACTGACCTGGTGCCACCTCCATCCTATACCGGATAGACCCCGGCGCCACATGACC
ATTGTTTTACCGAACATTGAGAAGTTATGAAATTCATTATTCTATGTCACCAGATGGAGGTTCTGTGACTTGTCTGTGGA
TCTAGGCTCGCCAACGACTATTTGCTGCGATTTATGGTATTCAGCGCCATAGGGATGCAAGATTATGTTTTTTTAAAATT
TTTGAATCATACATGTATCTTACGGGTTTCTCTACGTTATTTTGGTAGGACAAAGTTTACACCTTTCCCGCCCCGGATCA
AAATGACTATGGCATGATCCAACCCCTGCCTGCAAGCCAGCTTCTCTCTGAC
ATCACAATACCTGCTCCCATAAATACGC
TTGGGGCGTTTGCCTATCTGCGCCTTCATATCTGTGGGAGAGGCACGAGTGTTCTGTAGCAAGAAGGGGCAAATGGTATA
GCCTTGCAGCCCACCCGATCCTGTTTTATTCTGCATGGTTTCCGCGCGTGTTATTTTTGAAAACTACCTACCTATCCCCC
GATGAATTGAAGCCTTTTTGTCGTCATGGCTTTTTAACATTAGAATCAGTGCCGTGCCGGAACTTGTATCATAATTTATG
CCCGTAGTGGCCAGAAACTATGAGATCGTCGTAGGTCTCGTCCTACAGGTACTTGATGAACCAGCT

Genome context
Number of overlapped contigs
 
 
Comment  LB AAD6 3
Create date / Update date  2006-02-27 16:28:02 /
 
Copyright 2007 Fungal Plant Pathology Lab. & FBL
E-mail : yonglee@snu.ac.kr
Magnaporthe oryzae TDNA Database