T-DNA Browser >> T-DNA List >> T-DNA Detail Information
 
T-DNA Name  0009C41
Reference (Species)  Magnaporthe oryzae 5 CONTIG
Border (Vector / Readthrough)  LB (Minus) (Y)
Copy Number  1
Origin Info (ATMT)  ATMT0009C4
BLAST Search Result (2)  (Not defined) [2006-02-27 16:28:11]
 (Not defined) [2006-09-09 17:19:54]
There are 2 detail information.
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.193 : 846636 ~ 846636
Chromosome  7
TTL Info  
Locus Info  None (ORF DIS : 0 bp) (ORF Length : bp)
Near Locus Info  Near : 3' : MGG_02943.5 (2595 bp) (Minus)
 Far   : 5' : MGG_02944.5 (6136 bp) (Minus)
Range of Components
No Type Range Target
1 Border 12 ~ 61 (Plus)   8771 ~ 8822 (Minus)
2 ContigBorder 62 ~ 63 (-)  
3 Contig (193) 64 ~ 213 (Plus)   846634 ~ 846788 (Plus)
4 ContigTDNA 214 ~ 216 (-)  
5 TDNA 217 ~ 238 (Plus)   9063 ~ 9087 (Plus)
Sequences [A]
TACCGTCCCGCCAATGTGTTATTAAGTTGTCTAAGCGTCAATTTGTTTACACCACAATATATCATTTACCTTTTCTTCTT
GATCAGATCACGCTACACCACTTGCATGCGAACGCCCATTTTTCTCTTGGCACTACGCAGGGCACACACATACGCATCAA
ACTGCCGGAGGCTGTGAAGCAGATCTTGTCTTTATTATGGAGCTAATATGGTG
CTACTCTATTTCTTTGCCCTCGGACTG
TCAGGACTGAATCGATCTCAGCCATATCGGAATCGATCTCAGCCATATCGGAATCGATCTCAGCCATATCGGAATCGATC
TCAGCCATATCGGAATCGATCTCAGCCATATCGGAATCGATCTCACCCATATCGGAATCGATCTCAGCCATATCGAAATC
GATCTCAGCCATATCGGAATCAATCTCAGCCATATCGGAATCGATCTCACCCATATCGGAATCGATCTCACCCATATCGA
AATCGATCTCACCCATATCGAAATCGATCTCAGCCATATGAGAATCGATCTCACCCATATCGGAATCAATCTCGCCCATA
TCGGATTCGATCTCACCCATATCGAAAGAGATCTCAGCATTATCGGACTCGATCTCGCCCATATCAAAACAATCCGCCCC
CATAGCGAAGTCACTCTCCCCAGTGAGAAGCGATCTCCCCCCTACCGAGAGTCATCTCGCATACCGAAACCGATCCCCGC
CAATCGAAATAGCTCCCACCCAACGGAGAATAGACTGGCCATAGAGAAGCGATTGCA
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.196 : 3543734 ~ 3543734
Chromosome  1
Locus Info  None (ORF DIS : 0 bp) (ORF Length : bp)
Near Locus Info  Near : 3' : MGG_08826.5 (1003 bp) (Plus)
 Far   : 5' : MGG_08825.5 (1077 bp) (Plus)
Range of Components
No Type Range Target
1 Border 12 ~ 63 (Plus)   8771 ~ 8822 (Minus)
2 TDNA 214 ~ 232 (Plus)   9063 ~ 9087 (Plus)
3 ContigTDNA 233 ~ 238 (-)  
4 Contig (196) 239 ~ 255 (Plus)   3543903 ~ 3543925 (Plus)
Sequences [B]
TACCGTCCCGCCAATGTGTTATTAAGTTGTCTAAGCGTCAATTTGTTTACACCACAATATATCATTTACCTTTTCTTCTT
GATCAGATCACGCTACACCACTTGCATGCGAACGCCCATTTTTCTCTTGGCACTACGCAGGGCACACACATACGCATCAA
ACTGCCGGAGGCTGTGAAGCAGATCTTGTCTTTATTATGGAGCTAATATGGTGCTACTCTATTTCTTTGCCCTCGGACTG
TCAGGACTGAATCGA
TCTCAGCCATATCGGAATCGATCTCAGCCATATCGGAATCGATCTCAGCCATATCGGAATCGATC
TCAGCCATATCGGAATCGATCTCAGCCATATCGGAATCGATCTCACCCATATCGGAATCGATCTCAGCCATATCGAAATC
GATCTCAGCCATATCGGAATCAATCTCAGCCATATCGGAATCGATCTCACCCATATCGGAATCGATCTCACCCATATCGA
AATCGATCTCACCCATATCGAAATCGATCTCAGCCATATGAGAATCGATCTCACCCATATCGGAATCAATCTCGCCCATA
TCGGATTCGATCTCACCCATATCGAAAGAGATCTCAGCATTATCGGACTCGATCTCGCCCATATCAAAACAATCCGCCCC
CATAGCGAAGTCACTCTCCCCAGTGAGAAGCGATCTCCCCCCTACCGAGAGTCATCTCGCATACCGAAACCGATCCCCGC
CAATCGAAATAGCTCCCACCCAACGGAGAATAGACTGGCCATAGAGAAGCGATTGCA
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
Comment  LB AAD6 3
Create date / Update date  2006-02-27 16:28:02 /
 
Copyright 2007 Fungal Plant Pathology Lab. & FBL
E-mail : yonglee@snu.ac.kr
Magnaporthe oryzae TDNA Database