T-DNA Browser >> T-DNA List >> T-DNA Detail Information
 
T-DNA Name  0009D21
Reference (Species)  Magnaporthe oryzae 5 CONTIG
Border (Vector / Readthrough)  LB (Minus) (Y)
Copy Number  Not Exist!
Origin Info (ATMT)  ATMT0009D2
BLAST Search Result (2)  (Not defined) [2006-02-27 16:28:09]
 (Not defined) [2006-09-09 17:20:00]
There are 2 detail information.
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.195 : 2714090 ~ 2714090
Chromosome  1
TTL Info  
Locus Info  None (ORF DIS : 0 bp) (ORF Length : bp)
Near Locus Info  Near : 5' : MGG_08308.5 (94 bp) (Minus)
 Far   : 5' : MGG_08307.5 (974 bp) (Plus)
Range of Components
No Type Range Target
1 Border 23 ~ 66 (Plus)   8776 ~ 8820 (Minus)
2 Contig (195) 71 ~ 303 (Plus)   2714410 ~ 2714645 (Plus)
3 ContigOverlap 304 ~ 306 (Plus)  
4 Contig (195) 307 ~ 333 (Plus)   2714356 ~ 2714385 (Minus)
Sequences [A]
TAAATAACGCCGCCTACGTCGCATGTGTTATTAAGTTGTCTAAGCGTCATTTGTTTACACCACAATCTACAACTTTGTTT
CCTTCCTAATTAAACCACAATTACCGGTGACAAAACTAGTGAAGCTTGGGTAGTATCGATTTATTTCTTCACCGCAGTAC
TGTGTTTTTGGTAGGCTGTCACCAGGTATCTCTTGCATCATGTTTCATGATATGTTGACTCTACACCGTTTGCTTGTTTG
CCGATGATTCGGTGTCAAGCAATTGCTAGGGGCCTGTTTACATACCTACCTACGTGCTACAGT
GGGGCAACTCAGGTTTA
GCTGGTCTATGCT
ACTACACAATCGATCTCTTGCCTGTTTGAATCTTTCTTCTTGATCTCGGAATCTATCTGCACCATAT
AAGAATAGACCTCTGACAGATCGGAATAAACCTCTGCCCCTGCGGATCCGATCACCCTCATGGATAACGGGGGTTCAAAC
AATACAAACCCGTTCGGGTGGCTGCAGAAATCCTCTGCAACCAGTTGAGAGAATATCGGCACGGACTACAAATTTGACCT
GGGCTACTTCGAATCTCTGTACCCTCATGCGAATGACGTCTTTGTGATGTAGACAATGTTCATCGTGTGTCGGAGGATAT
CGTCTCGTGTCGCAGCAATTTGAGATGTATGTGGACTCATCCTCATTGATGCAAAGAAATACTGACTCTCTAACAAAATG
ATACACTGGCCTCTAAGACATACGTACACATCCATCTAGTCTCTGTCTGGTACATAAACGAAGC
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.186 : 2442436 ~ 2442436
Chromosome  2
TTL Info  
Locus Info  None (ORF DIS : 0 bp) (ORF Length : bp)
Near Locus Info  Near : 5' : MGG_06650.5 (58 bp) (Plus)
 Far   : 5' : MGG_06651.5 (1348 bp) (Minus)
Range of Components
No Type Range Target
1 Border 23 ~ 66 (Plus)   8776 ~ 8820 (Minus)
2 Contig (186) 468 ~ 571 (Plus)   2441627 ~ 2441730 (Minus)
3 Contig (186) 684 ~ 773 (Plus)   2441425 ~ 2441513 (Minus)
Sequences [B]
TAAATAACGCCGCCTACGTCGCATGTGTTATTAAGTTGTCTAAGCGTCATTTGTTTACACCACAATCTACAACTTTGTTT
CCTTCCTAATTAAACCACAATTACCGGTGACAAAACTAGTGAAGCTTGGGTAGTATCGATTTATTTCTTCACCGCAGTAC
TGTGTTTTTGGTAGGCTGTCACCAGGTATCTCTTGCATCATGTTTCATGATATGTTGACTCTACACCGTTTGCTTGTTTG
CCGATGATTCGGTGTCAAGCAATTGCTAGGGGCCTGTTTACATACCTACCTACGTGCTACAGTGGGGCAACTCAGGTTTA
GCTGGTCTATGCTACTACACAATCGATCTCTTGCCTGTTTGAATCTTTCTTCTTGATCTCGGAATCTATCTGCACCATAT
AAGAATAGACCTCTGACAGATCGGAATAAACCTCTGCCCCTGCGGATCCGATCACCCTCATGGATAACGGGGGTTCAAAC
AATACAAACCCGTTCGGGTGGCTGCAGAAATCCTCTGCAACCAGTTGAGAGAATATCGGCACGGACTACAAATTTGACCT
GGGCTACTTCG
AATCTCTGTACCCTCATGCGAATGACGTCTTTGTGATGTAGACAATGTTCATCGTGTGTCGGAGGATAT
CGTCTCGTGTCGCAGCAATTTGAGATGTATGTGGACTCATCCTCATTGATGCAAAGAAATACTGACTCTCTAACAAAATG
ATACACTGGCCTCTAAGACATACGTACACATCCATCTAGTCTCTGTCTGGTAC
ATAAACGAAGC
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
Comment  LB AAD6 3
Create date / Update date  2006-02-27 16:28:02 /
 
Copyright 2007 Fungal Plant Pathology Lab. & FBL
E-mail : yonglee@snu.ac.kr
Magnaporthe oryzae TDNA Database