T-DNA Browser >> T-DNA List >> T-DNA Detail Information
 
T-DNA Name  0009D41
Reference (Species)  Magnaporthe oryzae 5 CONTIG
Border (Vector / Readthrough)  LB (Minus) (Y)
Copy Number  Not Exist!
Origin Info (ATMT)  ATMT0009D4
BLAST Search Result (2)  (Not defined) [2006-02-27 16:28:11]
 (Not defined) [2006-09-09 17:20:18]
There are 1 detail information.
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.193 : 846636 ~ 846636
Chromosome  7
TTL Info  
Locus Info  None (ORF DIS : 0 bp) (ORF Length : bp)
Near Locus Info  Near : 3' : MGG_02943.5 (2595 bp) (Minus)
 Far   : 5' : MGG_02944.5 (6136 bp) (Minus)
Range of Components
No Type Range Target
1 Border 19 ~ 58 (Plus)   8771 ~ 8812 (Minus)
2 ContigBorder 59 ~ 60 (-)  
3 Contig (193) 61 ~ 211 (Plus)   846634 ~ 846787 (Plus)
Sequences [A]
CATTTTCCGGCTTGTGTTTTAAGTTGTCTAGGCGTCTATTTGTTCACACCACAAAATATCATTTAGCTTTTCTTCATAAT
CGATCGCGCTACGCCACTTGCATGCGAACGCCCGTTTTGCTCTTGGCGCTTCGCGGGGTACCCGTCTACTCGTCCCACTG
CCGGAGGCTGTGAAGCAGATCTTGTCTTTATTATGGAGCTAATATGGTGCT
CCTCTATTTCTTTGCCCTCGGACTGTTGG
GACTGAATCGACCCCATCCCTATAGTCTTCCCTCCCCTGCTTGCGTTTACCGAGCTCAACCCGGGCTTAGACTATCCTTT
GCCCGTCTGGATGTGTGTCTTTCCGGTATGTATTTTTCTTCTTCCGCACCGAGTCAATCTGCCCCCGAAAAATAATAACC
TCTCCCCGGACGTGTGTACTCTCTTCTCGGGCTTGTTCTTTTCTCTGTGGGGAAGGGGCCCTAACAAAACAACGAGCCGA
TTGTAATAAAATCTACTCCTTTCCCGATATGATTCCACTTCTTGCGAAAAAATGTGACTGGTAGCTTTTGATATACACTT
CAAGAAAAAAAACTATTTCTGAAAACCAGAACCACACACAGTGGACAGAAAGCGATTGCAAAGGGGCTATCCCCACGAGT
TGGATTTATCCCAATGCATAAAAGAGAGACTACTTTCCTCAAAAGAGAGCCCTCCCCCTACTAAAAACGCCACCTCCCCA
AGGATTGTATGATCTCACATACTTGAA
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
Comment  LB AAD6 3
Create date / Update date  2006-02-27 16:28:02 /
 
Copyright 2007 Fungal Plant Pathology Lab. & FBL
E-mail : yonglee@snu.ac.kr
Magnaporthe oryzae TDNA Database