T-DNA Browser >> T-DNA List >> T-DNA Detail Information
 
T-DNA Name  0009D61
Reference (Species)  Magnaporthe oryzae 5 CONTIG
Border (Vector / Readthrough)  LB (Minus) (Y) [Readthrough]
Copy Number  Not Exist!
Origin Info (ATMT)  ATMT0009D6
BLAST Search Result (2)  (Not defined) [2006-02-27 16:28:08]
 (Not defined) [2006-09-09 17:20:31]
There are 2 detail information.
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.190 : 1571768 ~ 1571768
Chromosome  5
TTL Info  
Locus Info  None (ORF DIS : 0 bp) (ORF Length : bp)
Near Locus Info  Near : 5' : MGG_12822.5 (136 bp) (Plus)
 Far   : 3' : MGG_06491.5 (776 bp) (Plus)
Range of Components
No Type Range Target
1 Border 22 ~ 125 (Plus)   8717 ~ 8820 (Minus)
2 Contig (190) 255 ~ 721 (Plus)   1571897 ~ 1572365 (Plus)
Sequences [A]
CAAAACGCCGCCTAACGTCGCATGTGTTATTAAGTTGTCTAAGCGTCAATTTGTTTACACCACAATATATCCTGTCACCA
GCCCGCCAACAGCTCCCCGACCGGCAGCTCGGCACAAAATCACCA
ATCCATCTCATCCATATCGGAATCAATTTCACCCT
TATCGAACTCCATCTCGCCCATATCGGACTCAATCTTCTACTTATATCAATCTCCCTATGCCTTTTTAACTATAGGTACA
CCCATACCGGAATCGCCTAAAATGCCGCAGGCATGCTCTCTTCCCGCCTGGGCCGAGCTTCCAGCTCACCGTGACTCCGT
GGGCAAGAGCTTCGTGCTCAAGAGGCCTTTGCTTCCGACCCTGAGCGCTTCTCCAAATTCACACGCACCTTCAAGCTCCC
AGAGTCCGTTGGCTCGACAGAGATCCTCTTTGACTTCAGAAAGAACTTTCTCACAGAGGAGACGCTCGACCTCCTGACCA
AGCTTGCCGAGCAAGCCAGAGTCGAGACGAAGCGTGAATCCATGTTCAAGGGCGAGAATATCAACTTCACCGAGGGCCGG
GCTGTCTACCACGCTGCGCTGCGCAATGTCAGATCAGAGCCGTGGCCCATGTCTGTCGAGGGTGTCGACGTTATGGGTGC
CCAGGGTGGTGTTAACGATGTCCTCGAGCACATGAAAGAGTTCTCATAGCAGTCCGAAGCCGCGAGTGGAAAGGTTACAC
A
CGCCACAGCTCACCACATTGTCACATTGGCGATGGGGGCCTCTGCATCCTGTAAG
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.194 : 3251691 ~ 3251691
Chromosome  6
Locus Info  MGG_00239.5 (ORF DIS : 2994 bp) (ORF Length : 3633 bp)
Near Locus Info  Near : 5' : MGG_00238.5 (4047 bp) (Plus)
 Far   : 5' : MGG_00241.5 (4789 bp) (Minus)
Range of Components
No Type Range Target
1 Border 22 ~ 125 (Plus)   8717 ~ 8820 (Minus)
2 Contig (194) 291 ~ 311 (Plus)   3251856 ~ 3251876 (Plus)
Sequences [B]
CAAAACGCCGCCTAACGTCGCATGTGTTATTAAGTTGTCTAAGCGTCAATTTGTTTACACCACAATATATCCTGTCACCA
GCCCGCCAACAGCTCCCCGACCGGCAGCTCGGCACAAAATCACCA
ATCCATCTCATCCATATCGGAATCAATTTCACCCT
TATCGAACTCCATCTCGCCCATATCGGACTCAATCTTCTACTTATATCAATCTCCCTATGCCTTTTTAACTATAGGTACA
CCCATACCGGAATCGCCTAAAATGCCGCAGGCATGCTCTCTTCCCGCCTGGGCCGAGCTTCCAGCTCACCGTGACTCCGT
GGGCAAGAGCTTCGTGCTCAAGAGGCCTTTGCTTCCGACCCTGAGCGCTTCTCCAAATTCACACGCACCTTCAAGCTCCC
AGAGTCCGTTGGCTCGACAGAGATCCTCTTTGACTTCAGAAAGAACTTTCTCACAGAGGAGACGCTCGACCTCCTGACCA
AGCTTGCCGAGCAAGCCAGAGTCGAGACGAAGCGTGAATCCATGTTCAAGGGCGAGAATATCAACTTCACCGAGGGCCGG
GCTGTCTACCACGCTGCGCTGCGCAATGTCAGATCAGAGCCGTGGCCCATGTCTGTCGAGGGTGTCGACGTTATGGGTGC
CCAGGGTGGTGTTAACGATGTCCTCGAGCACATGAAAGAGTTCTCATAGCAGTCCGAAGCCGCGAGTGGAAAGGTTACAC
ACGCCACAGCTCACCACATTGTCACATTGGCGATGGGGGCCTCTGCATCCTGTAAG
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
Comment  LB AAD6 3
Create date / Update date  2006-02-27 16:28:02 /
 
Copyright 2007 Fungal Plant Pathology Lab. & FBL
E-mail : yonglee@snu.ac.kr
Magnaporthe oryzae TDNA Database