T-DNA Browser >> T-DNA List >> T-DNA Detail Information
 
T-DNA Name  0010A57
Reference (Species)  Magnaporthe oryzae 5 CONTIG
Border (Vector / Readthrough)  LB (Minus) (Y)
Copy Number  Not Exist!
Origin Info (ATMT)  ATMT0010A5
BLAST Search Result (2)  (Not defined) [2006-02-27 16:28:09]
 (Not defined) [2006-09-09 17:21:19]
There are 1 detail information.
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.193 : 1342730 ~ 1342730
Chromosome  7
TTL Info  
Locus Info  MGG_02817.5 (ORF DIS : 245 bp) (ORF Length : 1719 bp)
Near Locus Info  Near : 3' : MGG_12588.5 (548 bp) (Minus)
 Far   : 5' : MGG_02818.5 (2587 bp) (Minus)
Range of Components
No Type Range Target
1 Border 25 ~ 73 (Plus)   8769 ~ 8820 (Minus)
2 ContigBorder 74 ~ 76 (-)  
3 Contig (193) 77 ~ 474 (Plus)   1341702 ~ 1342102 (Minus)
4 Contig (193) 500 ~ 705 (Plus)   1341469 ~ 1341676 (Minus)
Sequences [A]
AAAAAAAACCCCGCACTACGTCGCATGTGTTATTAAGTTGTCTAAGCGTCAATTTGTTTACACCACAATATATCCTCGAG
AAGTTTGCCCGGTACTTTGACGTCGAGGCGCGCATCCTGCCCGTGTCGGAAAAGAGCAGGTATCGGCTCGATGCCGACAT
GGTGCGCGACAACATTGACAAGAACACCATAGGGATTTTCATCATCCTGGGCAGCACCTATACGGGGCATTATGAGCCCA
TAGAGGAGATTTCCGAAATCTTGGACAAGTGAGTGTCACATTGGGATGTTGGACTCTTCAGTTGGTAGATGCAGAAGATA
CTGACATGGTCGTACTCCTGGGTTTAGGTACCAGGCTGAGACTGGGCATGATATCCCAATCCACGTTGATGGTGCAAGCG
GTGCTTTTATTGCCCCCTTTACTCATGCACAAGCTGGTGGACCCAAGTGGTAAGTTTTTAGTGTCCAAAAGAAG
AAAAAA
AAAATCCTCCAGGGGGTGTTTGAAAGCTGACAAAACCCACCAAAACCCGGGGATTCCTCACTCCCCAAAGTAAAATCCTT
CACCACCTCGGGCCACAAGTACGGCCTTTGTGACGGCCGGCGTTGGCTGAATCGTCTGGCGCAACAATTCTTCCTGCCCA
AGCACTCATCTTCGATACTGCACTTACTAGCAGCACGAGGAGTCGTACCCGCTTAACTTCTCGCG
CCCGCGCCAGTCATC
AGCATACTAACTCGTCATCAGGCAGCTACTAGCAGTACAGATCTGCAGTCTGCACCAGCTGTATCA
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
Comment  LB AAD6 3
Create date / Update date  2006-02-27 16:28:02 /
 
Copyright 2007 Fungal Plant Pathology Lab. & FBL
E-mail : yonglee@snu.ac.kr
Magnaporthe oryzae TDNA Database