T-DNA Browser >> T-DNA List >> T-DNA Detail Information
 
T-DNA Name  0010B11
Reference (Species)  Magnaporthe oryzae 5 CONTIG
Border (Vector / Readthrough)  LB (Minus) (Y) [Readthrough]
Copy Number  Not Exist!
Origin Info (ATMT)  ATMT0010B1
BLAST Search Result (2)  (Not defined) [2006-02-27 16:28:09]
 (Not defined) [2006-09-09 17:21:35]
There are 1 detail information.
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.183 : 107313 ~ 107313
Chromosome  3
TTL Info  
Locus Info  None (ORF DIS : 0 bp) (ORF Length : bp)
Near Locus Info  Near : 5' : MGG_07736.5 (2062 bp) (Plus)
 Far   : 5' : MGG_07734.5 (6320 bp) (Minus)
Range of Components
No Type Range Target
1 Border 30 ~ 120 (Plus)   8718 ~ 8812 (Minus)
2 Contig (183) 265 ~ 355 (Plus)   107079 ~ 107169 (Minus)
Sequences [A]
TAAAAACGCCGCGCAAAGTCGCATGTGTTTTAAGTTGTCTAAGCGTCATTTGTTTAACCACAATATATCCTGCCCCGGCC
GGCCTGAGATCCCCGACCGGCTCCTCGGCACAAAATCACC
TGTCGATCTCTGCCTGATCGAAAACGAATCTACGTAATGC
ATGCAACTGTCATCGGCTGTGCTTCTGTCTTGATGCTTTTTAAAATTTTTAACAAGATGATGTGCCATTTCTTTGCACTC
GAACTGTAATGACTGTTGCCCGGGGTGTGGGGCATCGACAAGGTAGGTAGGTTGACCGCGGCTTTACCCATCTACAAAGA
GGAGTGGTCGATCAAGCTGAGGGGGTGAACAGAAC
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGCATTTCGGCACTCG
CTTTTTGCCTTTCGGGGTTTTCCCCCTTTTTTCCCCCCCCCCTTTAAAAAACAATCGGGGGGGGGTCGGGGGGTTTTATT
TTTTTTTTTTCCCAAAAAAGGATTCCCCCCCCCCCTTCCAGAAATAATTCTCTCCTTTTGGGAAATAAACCACCCCCCAT
CCAAGTTCTGTCTCTGGAATTCGAAACAGCGATCCCCTTATCAGAAACACTCTCATCCATTCTAGAAAGACAACCCCCCC
CCTACGGGAAACAACTACTCCATAGCGGATGTGAGCTCACCCTTGGCGGGAACGATGTACTCACATAAGAGAATGGGCTA
TGCGAAAGCGAAAAGTACACCCCTCCTTTTTAGACCT
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
Comment  LB AAD6 3
Create date / Update date  2006-02-27 16:28:02 /
 
Copyright 2007 Fungal Plant Pathology Lab. & FBL
E-mail : yonglee@snu.ac.kr
Magnaporthe oryzae TDNA Database