T-DNA Browser >> T-DNA List >> T-DNA Detail Information
 
T-DNA Name  0010D14
Reference (Species)  Magnaporthe oryzae 5 CONTIG
Border (Vector / Readthrough)  LB (Minus) (Y)
Copy Number  Not Exist!
Origin Info (ATMT)  ATMT0010D1
BLAST Search Result (2)  (Not defined) [2006-02-27 16:28:10]
 (Not defined) [2006-09-09 17:20:29]
There are 2 detail information.
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.193 : 846619 ~ 846619
Chromosome  7
TTL Info  
Locus Info  None (ORF DIS : 0 bp) (ORF Length : bp)
Near Locus Info  Near : 3' : MGG_02943.5 (2612 bp) (Minus)
 Far   : 5' : MGG_02944.5 (6119 bp) (Minus)
Range of Components
No Type Range Target
1 Border 22 ~ 52 (Plus)   8790 ~ 8820 (Minus)
2 Contig (193) 68 ~ 219 (Plus)   846634 ~ 846788 (Plus)
3 ContigTDNA 220 ~ 222 (-)  
4 TDNA 223 ~ 244 (Plus)   9063 ~ 9087 (Plus)
Sequences [A]
TTTACGTACGACTAACGTCGCATGTGTTATTAAGTTGTCTATGCTTCAATTTTATTAACCACATATATCATTTACCTTTT
CTTCTTGATCAGATCACGCTACACCACTTGCATGCGAACGCCCTTTTTTCTCTTGGCACTACGCAGGGCACACACATACG
CATCAAACTGCCGGAGGCTGTGAAGCAGATCTTGTCTTTATTATGGAGCTAATATGGTG
CTACTCTATTTCTTTGCCCTC
GGAC
TGTCAGGACTGAATCGATCTCAGCCATATCGGAATCGATCTCAGACATATCGGAATCGATCTCACCCATATCGGAA
TCGATCTCACCCATATCGAAATCGACCTCAGCCATTTCGGAATCGCTCCCACCTATATGGAAAACGCTCTAGATTATACC
AAAATCGTTCTCTGCCATACGGAGGACAATCTGTCTAAATTGGGAACAGAACCTTCCCATATGAAAATGCCTCGAGCTCA
GGCAAATCCTATCCCCGCTTGGGGAAAAATAGGTCACTCCTTTTGAATCAGATATCACGGCAGGAGGGGAGACCTCCCCA
ACGTATGAAAAGAGTCGTTCACTAACTTGAGAGACAAACGCACCATTTTATCATGCACCCCCCCCCAGAGGAAAATAATG
TCCCCCTTTCTCAGAGCTATCCACCACAAACGAAAAACCATCCCCCATTGAAAAAGTGCCCCCCCACCTCACAAATGCTC
CCGACCAGTCAGGTATATCTCCCCTTTATGAGACTATCGCCTGGCAGATCAAGATAATACTCGCAC
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.196 : 3543717 ~ 3543717
Chromosome  1
Locus Info  None (ORF DIS : 0 bp) (ORF Length : bp)
Near Locus Info  Near : 3' : MGG_08826.5 (986 bp) (Plus)
 Far   : 5' : MGG_08825.5 (1094 bp) (Plus)
Range of Components
No Type Range Target
1 Border 22 ~ 52 (Plus)   8790 ~ 8820 (Minus)
2 TDNA 220 ~ 238 (Plus)   9063 ~ 9087 (Plus)
3 ContigTDNA 239 ~ 244 (-)  
4 Contig (196) 245 ~ 261 (Plus)   3543903 ~ 3543925 (Plus)
Sequences [B]
TTTACGTACGACTAACGTCGCATGTGTTATTAAGTTGTCTATGCTTCAATTTTATTAACCACATATATCATTTACCTTTT
CTTCTTGATCAGATCACGCTACACCACTTGCATGCGAACGCCCTTTTTTCTCTTGGCACTACGCAGGGCACACACATACG
CATCAAACTGCCGGAGGCTGTGAAGCAGATCTTGTCTTTATTATGGAGCTAATATGGTGCTACTCTATTTCTTTGCCCTC
GGAC
TGTCAGGACTGAATCGATCTCAGCCATATCGGAATCGATCTCAGACATATCGGAATCGATCTCACCCATATCGGAA
TCGATCTCACCCATATCGAAATCGACCTCAGCCATTTCGGAATCGCTCCCACCTATATGGAAAACGCTCTAGATTATACC
AAAATCGTTCTCTGCCATACGGAGGACAATCTGTCTAAATTGGGAACAGAACCTTCCCATATGAAAATGCCTCGAGCTCA
GGCAAATCCTATCCCCGCTTGGGGAAAAATAGGTCACTCCTTTTGAATCAGATATCACGGCAGGAGGGGAGACCTCCCCA
ACGTATGAAAAGAGTCGTTCACTAACTTGAGAGACAAACGCACCATTTTATCATGCACCCCCCCCCAGAGGAAAATAATG
TCCCCCTTTCTCAGAGCTATCCACCACAAACGAAAAACCATCCCCCATTGAAAAAGTGCCCCCCCACCTCACAAATGCTC
CCGACCAGTCAGGTATATCTCCCCTTTATGAGACTATCGCCTGGCAGATCAAGATAATACTCGCAC
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
Comment  LB AAD6 3
Create date / Update date  2006-02-27 16:28:02 /
 
Copyright 2007 Fungal Plant Pathology Lab. & FBL
E-mail : yonglee@snu.ac.kr
Magnaporthe oryzae TDNA Database