T-DNA Browser >> T-DNA List >> T-DNA Detail Information
 
T-DNA Name  0010D21
Reference (Species)  Magnaporthe oryzae 5 CONTIG
Border (Vector / Readthrough)  LB (Minus) (Y)
Copy Number  Not Exist!
Origin Info (ATMT)  ATMT0010D2
BLAST Search Result (2)  (Not defined) [2006-02-27 16:28:08]
 (Not defined) [2006-09-09 17:21:35]
There are 1 detail information.
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.193 : 846636 ~ 846636
Chromosome  7
TTL Info  
Locus Info  None (ORF DIS : 0 bp) (ORF Length : bp)
Near Locus Info  Near : 3' : MGG_02943.5 (2595 bp) (Minus)
 Far   : 5' : MGG_02944.5 (6136 bp) (Minus)
Range of Components
No Type Range Target
1 Border 12 ~ 60 (Plus)   8771 ~ 8820 (Minus)
2 Contig (193) 81 ~ 210 (Plus)   846656 ~ 846788 (Plus)
3 ContigTDNA 211 ~ 213 (-)  
4 TDNA 214 ~ 235 (Plus)   9063 ~ 9087 (Plus)
Sequences [A]
TAAGGTCCGGGATGTGTTATTAAGTTGCCTAGGCTTCTATTTGTTTAACCACAATATATCATTTACGTTTTCCCCAAGAA
CAGATCACGCTACACCACTTGCATGCGAACGCCCATTTTTCTCTTGGCGCTACGCAGGGCACACACATACGCATCAAACT
GCCGGAGGCTGTGAAGCAGATCTTGTCTTTATTATGGAGCTAATATGGTG
CTACTCTATTTCTTTGCCCTCGGACTGTCA
GGACTGTATCGATCTCAGCCATATCAGAATCGATCTCATCCCGATCTAAATCAATCTCACCCAAATCAAAATCGATCTCA
CCCAAACCGGAAGCGATTTTATCCATATCGAATTCAATCTCTTCCATATCTGAAGGAATCTCATTCATATCTTATTCCAT
CTCTCCCCCATCAAACTCAATCTCTCCCATACCGAACTCGATCTAACTCATCTCTATAGGGATCTTCTTCATCTCTAATT
AAAACACACCCACACCTTATTCGATATTACCCCTTCATATAGATCTCTCCCCCCCCTTATTGGACCATTCCTACGCCGAA
ATGAAGCCGTCCCTGCTAATAGGAATCTAACTTACCCCATAGAAACCTACTCCTACCCTAAATAAGCCATTCCCTCCTAT
ACTAAATGTATTCCTAACCAAAATAAATCAAATTCATCCAAAGAAAACGAAACCTACCCCAACAAAGACGAATTAACCCC
ACGAAAAGAGAAAACATCCGATTTTTTTTTTACACCA
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
Comment  LB AAD6 3
Create date / Update date  2006-02-27 16:28:02 /
 
Copyright 2007 Fungal Plant Pathology Lab. & FBL
E-mail : yonglee@snu.ac.kr
Magnaporthe oryzae TDNA Database