T-DNA Browser >> T-DNA List >> T-DNA Detail Information
 
T-DNA Name  0007B51
Reference (Species)  Magnaporthe oryzae 5 CONTIG
Border (Vector / Readthrough)  LB (Minus) (Y)
Copy Number  1
Origin Info (ATMT)  ATMT0007B5
BLAST Search Result (2)  (Not defined) [2006-02-27 16:57:24]
 (Not defined) [2006-09-09 17:21:45]
There are 1 detail information.
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.186 : 2088543 ~ 2088543
Chromosome  2
TTL Info  
Locus Info  MGG_06765.5 (ORF DIS : 653 bp) (ORF Length : 1785 bp)
Near Locus Info  Near : 5' : MGG_06764.5 (2265 bp) (Plus)
 Far   : 3' : MGG_06766.5 (4059 bp) (Plus)
Range of Components
No Type Range Target
1 Border 21 ~ 69 (Plus)   8766 ~ 8820 (Minus)
2 ContigBorder 70 ~ 75 (-)  
3 Contig (186) 76 ~ 691 (Plus)   2087928 ~ 2088549 (Minus)
Sequences [A]
ATAATACGCGCCTGCGTCGCATGTGTTATTAAGTTGTCTAAGCGTCAATTTGTTTACACCACAATATATCCTGCCGGCTC
TTGGCTGACCTGGGCCCGTGGCGGCATGGCTATAATGAGCATATACGAGGTTTTGTGGCTGGCCCTTTGGGTTGCCACCC
CTTTCCTCCTCGACTGGACTTGGACTGCACAGGTATTCCTGTTGCTGCACACCATGGTGCTTCTGATGAAGATGCACTCA
TACGTCTTCTACAATGGCCATCTCTCAAAAACCGAGAAGCGATTGCGCGCTCTTGATAACCCTTCAACGGCATCCAAGGC
ACCAGCCTACCTCTATCCCAGCGAGAACAAGGTGGCTAGTCCTAAGCGAACAACGGCTCCCAAATTTTTCCGAGATAACA
AGGCGGACGAGACAAGCAGCCCCCTCGAGACTTCTACGCTCTCAAAAGACGTGGATGATCGCGTAGGGGGCGACTGGCAC
GTCGACGGCGAGGATGATGACATTTCACAGCTCCGTGAGGACCTTGCGCGTGAGCTTACCAGTCCTATGGGAAACACGGC
TTACCCGCGCAATCTAACATTCTCCAACTACGTCGACTATCTTTTCTGTCCTACACTGTGCTACGAACTCGAATATCCGC
GCACCGAAAAGATTGACTGGCAGTCACTCATTAGCAAAATCATCGCTGTCT
ATGAATTAATTACAATAAATCGGACCATC
GTCAGAGAACAAGTTATCGCTGCGTGACCAGAATCAATTCCGGACACGC
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
Comment  LB-AAD6 2
Create date / Update date  2006-02-27 16:57:23 /
 
Copyright 2007 Fungal Plant Pathology Lab. & FBL
E-mail : yonglee@snu.ac.kr
Magnaporthe oryzae TDNA Database