T-DNA Browser >> T-DNA List >> T-DNA Detail Information
 
T-DNA Name  0007B61
Reference (Species)  Magnaporthe oryzae 5 CONTIG
Border (Vector / Readthrough)  None (N)
Copy Number  Not Exist!
Origin Info (ATMT)  ATMT0007B6
BLAST Search Result (2)  (Not defined) [2006-02-27 16:57:24]
 (Not defined) [2006-09-09 17:21:14]
There are 1 detail information.
     
Locus Info  None (ORF DIS : 0 bp) (ORF Length : bp)
Near Locus Info  Near : None : (0 bp) (None)
 Far   : None : (0 bp) (None)
Range of Components
No Type Range Target
1 Contig (175) 27 ~ 714 (Plus)   458673 ~ 459360 (Plus)
Sequences [A]
ACGCCTGTGTCTATATGTGTTATTAGTGGTAGCCCTGCAGAATTTTACCTTAATTTTGGGTGGAGCGAGCGAGCGAAAAA
TCAAAAGAGCGATTTGAACGCTTGCCGCGGAATGACTTGTCGAATAAACCCAAGGTTTCAAAGGGTCTCGAAACTCAAAA
ACCACTATCAGCCTAGCGTTTAATTCAGCAAGAACTAGGGTGCCTGCATGTTCGCCGTATATAAAGAGACGAGATGGAGA
TCAAAACAATTGTCATATTTGCAGTTGCTGCAGTCTGATCATTGGGTTCGATCCTTTCACCTCAGCTATTCTACTTCGAG
GTACCTACCCAACTCCCTATTTTTAAAAATGGTATTAAATGTCAGTTCTAGCAAATTCTGACCGACTCTTGTCTGGGTTG
CCGCGCTGGTCTCCGGTCTCCGCCCAATTGCTGCAGTCAGTCAATAATATTCGTGTACAGCGTCCCGCGGGCTTGGCAGA
TCTAAGTTAGCATGAGCACCCCTGCAGCCCATGCAAGGAAGCTGAGGAAGTAAAGTCAAGGTCCTAGGCCTGAAAACCAA
AACTTCTCGAGCTGCCGACAAACACTCGCTTGCAATTGATTCTTTTTGTATCGCGCCGTGTGCTCTATCCCCGACACTGA
TCCCTTTGCTGGGTTTTCACCTGTCGTGTTCTTGCTCGACCTGCTGGCAGTTTACTATAATTTGTTCACTTCCC
TTTTTT
TTTCTGTCTCAATTCAAGCGATGTG
Genome context
Number of overlapped contigs
 
 
Comment  LB-AAD6 2
Create date / Update date  2006-02-27 16:57:23 /
 
Copyright 2007 Fungal Plant Pathology Lab. & FBL
E-mail : yonglee@snu.ac.kr
Magnaporthe oryzae TDNA Database