T-DNA Browser >> T-DNA List >> T-DNA Detail Information
 
T-DNA Name  0007C11
Reference (Species)  Magnaporthe oryzae 5 CONTIG
Border (Vector / Readthrough)  LB (Minus) (Y)
Copy Number  1
Origin Info (ATMT)  ATMT0007C1
BLAST Search Result (2)  (Not defined) [2006-02-27 16:57:24]
 (Not defined) [2006-09-09 17:20:03]
There are 2 detail information.
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.186 : 592400 ~ 592400
Chromosome  2
TTL Info  
Locus Info  None (ORF DIS : 0 bp) (ORF Length : bp)
Near Locus Info  Near : 5' : MGG_09281.5 (113 bp) (Plus)
 Far   : 3' : MGG_09282.5 (206 bp) (Plus)
Range of Components
No Type Range Target
1 Border 20 ~ 47 (Plus)   8789 ~ 8820 (Minus)
2 ContigBorder 48 ~ 50 (-)  
3 Contig (186) 51 ~ 337 (Plus)   592113 ~ 592403 (Minus)
Sequences [A]
CTGGCTGTTACTGTACTCGATGTGTTATTAGTTGTCTAAGCGTCAATTTGCGCCGACCTACCTCTGGACTTTTGGAGGGG
CACTCTTCCGTCATGGCCCACTCCGTAGTCTTCGATTGGCAAGAGGAGGGTAGGTAGGAAGAAGGGTCGGTGAACCCCTG
AACCGGAGGAGTAACTTGAGCTTTATAATTGTCAACTTGGGGGTTCAACACAAAAGTACTTTCTGAGTGCAGACGCTAAG
ACACACAGTCAAATATCACCCAATCATGTCTCCAATCAAGAAGGCCCGGAACCTCTCCATGGCATCCCTGAGCCGAATGA
GCACCCCGGCAGCCAAC
GTGGTCTCGCGCGTTGGTGTTTCGTTCATATCAGAGGATCAGGCATGCACGAACCTGGATCAG
CAGATTCCCGAAAGCACGTCTATCTCACAACTGCGACAGAAAACAAGGGATGTCTGGAACACTGATGTCCTCTCTAGAGT
GGCTTCCAACGATAAAAACACGACCAAGTTGCAGCATCTGTACACCTCTATGTACTTCATGCATCTGATGCCGATCAACA
AAAACCGGAGAGAACCCAGAAGTGGAAATCGATCTCCCCCCATATCGGG
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.195 : 1279509 ~ 1279509
Chromosome  1
TTL Info  
Locus Info  MGG_07146.5 (ORF DIS : 499 bp) (ORF Length : 2679 bp)
Near Locus Info  Near : 5' : MGG_12355.5 (1416 bp) (Minus)
 Far   : 3' : MGG_07147.5 (2864 bp) (Minus)
Range of Components
No Type Range Target
1 Border 20 ~ 50 (Plus)   8789 ~ 8820 (Minus)
2 Contig (195) 332 ~ 592 (Plus)   1279790 ~ 1280048 (Plus)
Sequences [B]
CTGGCTGTTACTGTACTCGATGTGTTATTAGTTGTCTAAGCGTCAATTTGCGCCGACCTACCTCTGGACTTTTGGAGGGG
CACTCTTCCGTCATGGCCCACTCCGTAGTCTTCGATTGGCAAGAGGAGGGTAGGTAGGAAGAAGGGTCGGTGAACCCCTG
AACCGGAGGAGTAACTTGAGCTTTATAATTGTCAACTTGGGGGTTCAACACAAAAGTACTTTCTGAGTGCAGACGCTAAG
ACACACAGTCAAATATCACCCAATCATGTCTCCAATCAAGAAGGCCCGGAACCTCTCCATGGCATCCCTGAGCCGAATGA
GCACCCCGGCAGCCAACGTGGTCTCGCGCGTTGGTGTTTCGTTCATATCAGAGGATCAGGCATGCACGAACCTGGATCAG
CAGATTCCCGAAAGCACGTCTATCTCACAACTGCGACAGAAAACAAGGGATGTCTGGAACACTGATGTCCTCTCTAGAGT
GGCTTCCAACGATAAAAACACGACCAAGTTGCAGCATCTGTACACCTCTATGTACTTCATGCATCTGATGCCGATCAACA
AAAACCGGAGAGAACCCAGAAGTGGAAATCGA
TCTCCCCCCATATCGGG
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
Comment  LB-AAD6 2
Create date / Update date  2006-02-27 16:57:23 /
 
Copyright 2007 Fungal Plant Pathology Lab. & FBL
E-mail : yonglee@snu.ac.kr
Magnaporthe oryzae TDNA Database