T-DNA Browser >> T-DNA List >> T-DNA Detail Information
 
T-DNA Name  0007C51
Reference (Species)  Magnaporthe oryzae 5 CONTIG
Border (Vector / Readthrough)  LB (Minus) (Y)
Copy Number  Not Exist!
Origin Info (ATMT)  ATMT0007C5
BLAST Search Result (2)  (Not defined) [2006-02-27 16:57:24]
 (Not defined) [2006-09-09 17:21:24]
There are 1 detail information.
     
Insertional Position  Magnaporthe grisea 70-15 supercontig 5.175 : 721631 ~ 721631
Chromosome  3
TTL Info  
Locus Info  None (ORF DIS : 0 bp) (ORF Length : bp)
Near Locus Info  Near : 5' : MGG_05134.5 (524 bp) (Minus)
 Far   : 5' : MGG_12936.5 (1811 bp) (Plus)
Range of Components
No Type Range Target
1 Border 22 ~ 72 (Plus)   8768 ~ 8820 (Minus)
2 ContigBorder 73 ~ 74 (-)  
3 Contig (175) 75 ~ 721 (Plus)   721629 ~ 722278 (Plus)
Sequences [A]
GAAAAACGCCGCCTGCGTCGCATGTGTTATTAAGTTGTCTAAGCGTCAATTTGTTTACACCACAATATATCCTGGATTCA
TGACATTCTTTGTCAATGTAGAAGGACACTAAAATGACCATAAAACTCCTCCCCCACCAATCATGATAGTCTTTCCGTTT
TCACATATTCCACCGATCCTTTCGGCGCTCTCTGCCATCTTAAACCCTCTGCACCTCTTAATTTCCTTGGTTTGCCCAAT
GTCAGCTTGCTGCGTGCATGATCTCCGTCTTTACAGTACTTTGCAGAGCCAACCCTTAAATGAGCAAGAAGACGGCCGGG
CTGTCGCTTCAATATTGCAATGTGCATACTCGCAAAAGTTGCAATTTTAGGGACACGTTTTCTACGAGCGCCTTGACAAG
AACCAAGTATCATCTTCCAAAGTTGAAAATTTGCTTTGAAGCCAACCCAGAGAAGGTCGATTCTATTGCAAATCAACCGG
TGCAATCAATATAGTGCTAACTTTGTAAATTTATTTCCACCTGCGTACCTACTTGGATACATCCACCACACACCTAGGGA
GGTATGCAGGCATTTGTGTGAACTAAGCTGCTTGTGCATACCGGCCCCAGACCTACGGATACGGAAGCGCTAACGACTAT
TTCCGTCTTTGACCTCAAACCGGATTGAACACGGAAATTTCCGAATTACAGACATACACAGTAGATCTCCGGGCCATCTA
A
TTGTGTCAAAACGACAAAAAAAGTCGTCTTTTTTTTGT
Diagram of TDNA
Genome context
Number of overlapped contigs
 
 
Comment  LB-AAD6 2
Create date / Update date  2006-02-27 16:57:23 /
 
Copyright 2007 Fungal Plant Pathology Lab. & FBL
E-mail : yonglee@snu.ac.kr
Magnaporthe oryzae TDNA Database